Transcript: Human XM_005272075.3

PREDICTED: Homo sapiens voltage dependent anion channel 1 (VDAC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VDAC1 (7416)
Length:
1950
CDS:
243..1094

Additional Resources:

NCBI RefSeq record:
XM_005272075.3
NBCI Gene record:
VDAC1 (7416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029128 CAAGTACAGATGGACTGAGTA pLKO.1 422 CDS 100% 4.950 3.465 N VDAC1 n/a
2 TRCN0000278508 CAAGTACAGATGGACTGAGTA pLKO_005 422 CDS 100% 4.950 3.465 N VDAC1 n/a
3 TRCN0000029125 CGATTCATCCTTCTCACCTAA pLKO.1 539 CDS 100% 4.950 3.465 N VDAC1 n/a
4 TRCN0000297149 CGATTCATCCTTCTCACCTAA pLKO_005 539 CDS 100% 4.950 3.465 N VDAC1 n/a
5 TRCN0000029127 GCAGTTGGCTACAAGACTGAT pLKO.1 750 CDS 100% 4.950 3.465 N VDAC1 n/a
6 TRCN0000297481 GCAGTTGGCTACAAGACTGAT pLKO_005 750 CDS 100% 4.950 3.465 N VDAC1 n/a
7 TRCN0000029126 GCTTGGTCTAGGACTGGAATT pLKO.1 1064 CDS 100% 0.000 0.000 N VDAC1 n/a
8 TRCN0000278564 GCTTGGTCTAGGACTGGAATT pLKO_005 1064 CDS 100% 0.000 0.000 N VDAC1 n/a
9 TRCN0000029124 GCTATGGATTTGGCTTAATAA pLKO.1 304 CDS 100% 15.000 9.000 N VDAC1 n/a
10 TRCN0000278509 GCTATGGATTTGGCTTAATAA pLKO_005 304 CDS 100% 15.000 9.000 N VDAC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01764 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01764 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471824 TCACGTACGTACGATATGCACGAG pLX_317 39.8% 100% 100% V5 n/a
Download CSV