Transcript: Mouse XM_017314500.1

PREDICTED: Mus musculus voltage-dependent anion channel 1 (Vdac1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vdac1 (22333)
Length:
2132
CDS:
161..1258

Additional Resources:

NCBI RefSeq record:
XM_017314500.1
NBCI Gene record:
Vdac1 (22333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012389 GCTACGGCTTTGGCTTAATAA pLKO.1 468 CDS 100% 15.000 21.000 N Vdac1 n/a
2 TRCN0000297135 GCTACGGCTTTGGCTTAATAA pLKO_005 468 CDS 100% 15.000 21.000 N Vdac1 n/a
3 TRCN0000012388 GAGTTGATAAATACCACGTTA pLKO.1 1355 3UTR 100% 4.950 6.930 N Vdac1 n/a
4 TRCN0000278150 GAGTTGATAAATACCACGTTA pLKO_005 1355 3UTR 100% 4.950 6.930 N Vdac1 n/a
5 TRCN0000012391 GTTGGCTATAAGACGGATGAA pLKO.1 917 CDS 100% 4.950 6.930 N Vdac1 n/a
6 TRCN0000278081 GTTGGCTATAAGACGGATGAA pLKO_005 917 CDS 100% 4.950 6.930 N Vdac1 n/a
7 TRCN0000012392 ACCAGGTATCAAACTGACGTT pLKO.1 1162 CDS 100% 2.640 3.696 N Vdac1 n/a
8 TRCN0000278151 ACCAGGTATCAAACTGACGTT pLKO_005 1162 CDS 100% 2.640 3.696 N Vdac1 n/a
9 TRCN0000029128 CAAGTACAGATGGACTGAGTA pLKO.1 586 CDS 100% 4.950 3.465 N VDAC1 n/a
10 TRCN0000278508 CAAGTACAGATGGACTGAGTA pLKO_005 586 CDS 100% 4.950 3.465 N VDAC1 n/a
11 TRCN0000069343 CCAGCTTCATACTAATGTGAA pLKO.1 940 CDS 100% 4.950 3.465 N LOC234187 n/a
12 TRCN0000012390 GCCTGGAAACCAAGTACAGAT pLKO.1 576 CDS 100% 4.950 3.465 N Vdac1 n/a
13 TRCN0000297136 GCCTGGAAACCAAGTACAGAT pLKO_005 576 CDS 100% 4.950 3.465 N Vdac1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01764 pDONR223 100% 69.6% 76.4% None (many diffs) n/a
2 ccsbBroad304_01764 pLX_304 0% 69.6% 76.4% V5 (many diffs) n/a
3 TRCN0000471824 TCACGTACGTACGATATGCACGAG pLX_317 39.8% 69.6% 76.4% V5 (many diffs) n/a
Download CSV