Construct: ORF TRCN0000471831
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005279.1_s317c1
- Derived from:
- ccsbBroadEn_01447
- DNA Barcode:
- TCGTATTCCCCCACCGAGACCGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPS6KA3 (6197)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471831
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | NM_004586.3 | 100% | 100% | |
| 2 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_005274573.2 | 99.8% | 99.8% | 1224_1225insCAG |
| 3 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_011545556.1 | 99% | 99% | 932_949del;1242_1243insCAG |
| 4 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_011545555.1 | 97.9% | 97.3% | (many diffs) |
| 5 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_011545563.3 | 96.2% | 96.2% | 0_1ins84 |
| 6 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_017029713.1 | 96.2% | 96.2% | 0_1ins84 |
| 7 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_017029714.2 | 96.2% | 96.2% | 0_1ins84 |
| 8 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_017029715.2 | 96.2% | 96.2% | 0_1ins84 |
| 9 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_017029716.1 | 96.2% | 96.2% | 0_1ins84 |
| 10 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_017029717.2 | 96.2% | 96.2% | 0_1ins84 |
| 11 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_006724507.3 | 96% | 96% | 0_1ins84;1140_1141insCAG |
| 12 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_017029719.2 | 96% | 96% | 0_1ins84;1140_1141insCAG |
| 13 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_011545557.2 | 95.4% | 95.4% | 0_1ins84;848_865del |
| 14 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_011545558.2 | 95.4% | 95.4% | 0_1ins84;848_865del |
| 15 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_011545560.1 | 95.4% | 95.4% | 0_1ins84;848_865del |
| 16 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_011545561.2 | 95.4% | 95.4% | 0_1ins84;848_865del |
| 17 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_017029718.2 | 94.7% | 94% | (many diffs) |
| 18 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_005274577.3 | 94.6% | 93.9% | (many diffs) |
| 19 | human | 6197 | RPS6KA3 | ribosomal protein S6 kinase A3 | XM_011545562.2 | 94% | 93.3% | (many diffs) |
| 20 | mouse | 110651 | Rps6ka3 | ribosomal protein S6 kinase... | NM_148945.2 | 94.4% | 99.8% | (many diffs) |
| 21 | mouse | 110651 | Rps6ka3 | ribosomal protein S6 kinase... | XM_017318353.1 | 91.5% | 96.7% | (many diffs) |
| 22 | mouse | 110651 | Rps6ka3 | ribosomal protein S6 kinase... | NM_001346675.1 | 90.7% | 96% | (many diffs) |
| 23 | mouse | 110651 | Rps6ka3 | ribosomal protein S6 kinase... | XM_006528687.1 | 90.7% | 96% | (many diffs) |
| 24 | mouse | 110651 | Rps6ka3 | ribosomal protein S6 kinase... | XM_017318354.1 | 90.7% | 96% | (many diffs) |
| 25 | mouse | 110651 | Rps6ka3 | ribosomal protein S6 kinase... | XM_017318355.1 | 90.7% | 96% | (many diffs) |
| 26 | mouse | 110651 | Rps6ka3 | ribosomal protein S6 kinase... | XM_006528688.2 | 89.3% | 94% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2289
- ORF length:
- 2220
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccgctggcg cagctggcgg acccgtggca gaagatggct gtggagagcc 121 cgtccgacag cgctgagaat ggacagcaaa ttatggatga acctatggga gaggaggaga 181 ttaacccaca aactgaagaa gtcagtatca aagaaattgc aatcacacat catgtaaagg 241 aaggacatga aaaggcagat ccttcccagt ttgaactttt aaaagtatta gggcagggat 301 catttggaaa ggttttctta gttaaaaaaa tctcaggctc tgatgctagg cagctttatg 361 ccatgaaggt attgaagaag gccacactga aagttcgaga ccgagttcgg acaaaaatgg 421 aacgtgatat cttggtagag gttaatcatc cttttattgt caagttgcat tatgcttttc 481 aaactgaagg gaagttgtat cttattttgg attttctcag gggaggagat ttgtttacac 541 gcttatccaa agaggtgatg ttcacagaag aagatgtcaa attctacttg gctgaacttg 601 cacttgcttt agaccatcta catagcctgg gaataattta tagagactta aaaccagaaa 661 atatacttct tgatgaagaa ggtcacatca agttaacaga tttcggccta agtaaagagt 721 ctattgacca tgaaaagaag gcatattctt tttgtggaac tgtggagtat atggctccag 781 aagtagttaa tcgtcgaggt catactcaga gtgctgactg gtggtctttt ggtgtgttaa 841 tgtttgaaat gcttactggt acactccctt tccaaggaaa agatcgaaaa gaaacaatga 901 ctatgattct taaagccaaa cttggaatgc cacagttttt gagtcctgaa gcgcagagtc 961 ttttacgaat gcttttcaag cgaaatcctg caaacagatt aggtgcagga ccagatggag 1021 ttgaagaaat taaaagacat tcatttttct caacgataga ctggaataaa ctgtatagaa 1081 gagaaattca tccgccattt aaacctgcaa cgggcaggcc tgaagataca ttctattttg 1141 atcctgagtt tactgcaaaa actcccaaag attcacctgg cattccacct agtgctaatg 1201 cacatcagct ttttcggggg tttagttttg ttgctattac ctcagatgat gaaagccaag 1261 ctatgcagac agttggtgta cattcaattg ttcagcagtt acacaggaac agtattcagt 1321 ttactgatgg atatgaagta aaagaagata ttggagttgg ctcctactct gtttgcaaga 1381 gatgtataca taaagctaca aacatggagt ttgcagtgaa gattattgat aaaagcaaga 1441 gagacccaac agaagaaatt gaaattcttc ttcgttatgg acagcatcca aacattatca 1501 ctctaaagga tgtatatgat gatggaaagt atgtgtatgt agtaacagaa cttatgaaag 1561 gaggtgaatt gctggataaa attcttagac aaaaattttt ctctgaacga gaggccagtg 1621 ctgtcctgtt cactataact aaaaccgttg aatatcttca cgcacaaggg gtggttcata 1681 gagacttgaa acctagcaac attctttatg tggatgaatc tggtaatccg gaatctattc 1741 gaatttgtga ttttggcttt gcaaaacagc tgagagcgga aaatggtctt ctcatgactc 1801 cttgttacac tgcaaatttt gttgcaccag aggttttaaa aagacaaggc tatgatgctg 1861 cttgtgatat atggagtctt GGTGTCCTAC TCTATACAAT GCTTACCGGT TACACTCCAT 1921 TTGCAAATGG TCCTGATGAT ACACCAGAGG AAATATTGGC ACGAATAGGT AGCGGAAAAT 1981 TCTCACTCAG TGGTGGTTAC TGGAATTCTG TTTCAGACAC AGCAAAGGAC CTGGTGTCAA 2041 AGATGCTTCA TGTAGACCCT CATCAGAGAC TGACTGCTGC TCTTGTGCTC AGACATCCTT 2101 GGATCGTCCA CTGGGACCAA CTGCCACAAT ACCAACTAAA CAGACAGGAT GCACCACATC 2161 TAGTAAAGGG TGCCATGGCA GCTACATATT CTGCTTTGAA CCGTAATCAG TCACCAGTTT 2221 TGGAACCAGT AGGCCGCTCT ACTCTTGCTC AGCGGAGAGG TATTAAAAAA ATCACCTCAA 2281 CAGCCCTGTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 2341 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 2401 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATCGTAT TCCCCCACCG AGACCGTAAC 2461 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt