Transcript: Mouse NM_148945.2

Mus musculus ribosomal protein S6 kinase polypeptide 3 (Rps6ka3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rps6ka3 (110651)
Length:
7320
CDS:
339..2561

Additional Resources:

NCBI RefSeq record:
NM_148945.2
NBCI Gene record:
Rps6ka3 (110651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427598 GTATTAGGGCAGGGATCATTT pLKO_005 555 CDS 100% 13.200 18.480 N Rps6ka3 n/a
2 TRCN0000022727 GCTTACTGGTTACACTCCATT pLKO.1 2171 CDS 100% 4.950 6.930 N Rps6ka3 n/a
3 TRCN0000196854 GAAGGGAAGTTGTATCTTATT pLKO.1 756 CDS 100% 13.200 9.240 N RPS6KA3 n/a
4 TRCN0000022724 GCCGTGAAGATTATTGATAAA pLKO.1 1683 CDS 100% 13.200 9.240 N Rps6ka3 n/a
5 TRCN0000423640 ATGGCTCCAGAAGTAGTTAAC pLKO_005 1041 CDS 100% 10.800 7.560 N Rps6ka3 n/a
6 TRCN0000424696 GTGAATTGCTGGATAAGATTC pLKO_005 1834 CDS 100% 10.800 7.560 N Rps6ka3 n/a
7 TRCN0000022726 GCTCACTGGTACACTACCTTT pLKO.1 1121 CDS 100% 4.950 3.465 N Rps6ka3 n/a
8 TRCN0000022725 GCTCTGATGCTAGACAGCTTT pLKO.1 607 CDS 100% 4.950 3.465 N Rps6ka3 n/a
9 TRCN0000022728 CGGAGACTTGTTTACACGCTT pLKO.1 794 CDS 100% 2.640 1.848 N Rps6ka3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01447 pDONR223 100% 94.4% 99.8% None (many diffs) n/a
2 ccsbBroad304_01447 pLX_304 0% 94.4% 99.8% V5 (many diffs) n/a
3 TRCN0000471831 TCGTATTCCCCCACCGAGACCGTA pLX_317 18.6% 94.4% 99.8% V5 (many diffs) n/a
4 TRCN0000488682 TCCTCACCAGAGTCAACCGTCCAT pLX_317 16.4% 94.4% 99.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14832 pDONR223 72% 94.1% 30.4% None (many diffs) n/a
6 ccsbBroad304_14832 pLX_304 0% 94.1% 30.4% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000473411 AAGCCAAGCGATTACCGCTTACGG pLX_317 15.2% 94.1% 30.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV