Construct: ORF TRCN0000471883
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001263.1_s317c1
- Derived from:
- ccsbBroadEn_00904
- DNA Barcode:
- GCACTGAAAAAAATGCTCCCACAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNQ2 (3785)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471883
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | NM_172109.3 | 100% | 100% | |
2 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | NM_172108.5 | 45.4% | 44.8% | (many diffs) |
3 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | NM_004518.6 | 45.3% | 44.5% | (many diffs) |
4 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | XM_017027844.2 | 45.1% | 44.2% | (many diffs) |
5 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | NM_172106.3 | 45% | 44.2% | (many diffs) |
6 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | XM_017027842.2 | 44.3% | 43.4% | (many diffs) |
7 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | NM_172107.4 | 43.8% | 43.2% | (many diffs) |
8 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | XM_011528811.2 | 43.5% | 42.7% | (many diffs) |
9 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | XM_017027841.2 | 43.3% | 42.4% | (many diffs) |
10 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | XM_011528810.2 | 43.2% | 42.4% | (many diffs) |
11 | human | 3785 | KCNQ2 | potassium voltage-gated cha... | XM_017027843.1 | 36.8% | 32.2% | (many diffs) |
12 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | NM_001006674.2 | 59.9% | 65.3% | (many diffs) |
13 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315768.1 | 54.8% | 60.2% | (many diffs) |
14 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | NM_001006669.2 | 47.3% | 51.5% | (many diffs) |
15 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | NM_001003825.3 | 45.3% | 49.4% | (many diffs) |
16 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | NM_001003824.2 | 45% | 49.1% | (many diffs) |
17 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | NM_001006668.2 | 45% | 49.9% | (many diffs) |
18 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_006500567.1 | 40.6% | 44.3% | (many diffs) |
19 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_006500568.1 | 40.6% | 44.6% | (many diffs) |
20 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315763.1 | 40.6% | 44.5% | (many diffs) |
21 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315767.1 | 40.5% | 44.9% | (many diffs) |
22 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | NM_001302888.1 | 40.1% | 44% | (many diffs) |
23 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_006500565.1 | 40% | 43.9% | (many diffs) |
24 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315753.1 | 39.2% | 43.1% | (many diffs) |
25 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315751.1 | 39.2% | 42.7% | (many diffs) |
26 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | NM_010611.3 | 39.2% | 43% | (many diffs) |
27 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315747.1 | 39% | 42.5% | (many diffs) |
28 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315754.1 | 38.9% | 43.1% | (many diffs) |
29 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315746.1 | 37.8% | 41.5% | (many diffs) |
30 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315743.1 | 37.6% | 41% | (many diffs) |
31 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_011239925.1 | 37.6% | 41.3% | (many diffs) |
32 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315744.1 | 37.6% | 41.2% | (many diffs) |
33 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315740.1 | 37.3% | 40.2% | (many diffs) |
34 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315742.1 | 37.1% | 40.7% | (many diffs) |
35 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315741.1 | 36.9% | 40.4% | (many diffs) |
36 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315738.1 | 36.4% | 40% | (many diffs) |
37 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XM_017315735.1 | 36.4% | 39.9% | (many diffs) |
38 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XR_001781086.1 | 33.5% | (many diffs) | |
39 | mouse | 16536 | Kcnq2 | potassium voltage-gated cha... | XR_001781085.1 | 33% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1245
- ORF length:
- 1179
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaat 61 ttggcatggt gcagaagtcg cgcaacggcg gcgtataccc cggcccgagc ggggagaaga 121 agctgaaggt gggcttcgtg gggctggacc ccggcgcgcc cgactccacc cgggacgggg 181 cgctgctgat cgccggctcc gaggccccca agcgcggcag catcctcagc aaacctcgcg 241 cgggcggcgc gggcgccggg aagcccccca agcgcaacgc cttctaccgc aagctgcaga 301 atttcctcta caacgtgctg gagcggccgc gcggctgggc gttcatctac cacgcctacg 361 tgttcctcct ggttttctcc tgcctcgtgc tgtctgtgtt ttccaccatc aaggagtatg 421 agaagagctc ggagggggcc ctctacatcc tggaaatcgt gactatcgtg gtgtttggcg 481 tggagtactt cgtgcggatc tgggccgcag gctgctgctg ccggtaccgt ggctggaggg 541 ggcggctcaa gtttgcccgg aaaccgttct gtgtgattga catcatggtg ctcatcgcct 601 ccattgcggt gctggccgcc ggctcccagg gcaacgtctt tgccacatct gcgctccgga 661 gcctgcgctt cctgcagatt ctgcggatga tccgcatgga ccggcgggga ggcacctgga 721 agctgctggg ctctgtggtc tatgcccaca gcaaggagct ggtcactgcc tggtacatcg 781 gcttccttTG TCTCATCCTG GCCTCGTTCC TGGTGTACTT GGCAGAGAAG GGGGAGAACG 841 ACCACTTTGA CACCTACGCG GATGCACTCT GGTGGGGCCT GATCACGCTG ACCACCATTG 901 GCTACGGGGA CAAGTACCCC CAGACCTGGA ACGGCAGGCT CCTTGCGGCA ACCTTCACCC 961 TCATCGGTGT CTCCTTCTTC GCGCTGCCTG CAGGCATCTT GGGGTCTGGG TTTGCCCTGA 1021 AGGTTCAGGA GCAGCACAGG CAGAAGCACT TTGAGAAGAG GCGGAACCCG GCAGCAGGCC 1081 TGATCCAGTC GGCCTGGAGA TTCTACGCCA CCAACCTCTC GCGCACAGAC CTGCACTCCA 1141 CGTGGCAGTA CTACGAGCGA ACGGTCACCG TGCCCATGTA CAGGTACCGC CGCCGGGCAC 1201 CTGCCACCAA GCAACTGTTT CATTTTTTAT TTTCCATTTG TTCTTACCCA ACTTTCTTGT 1261 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1321 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1381 GAAAGGACGA GCACTGAAAA AAATGCTCCC ACAGACGCGT TAAGTCgaca atcaacctct 1441 ggattacaaa atttgtgaaa gatt