Transcript: Human NM_004518.6

Homo sapiens potassium voltage-gated channel subfamily Q member 2 (KCNQ2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
KCNQ2 (3785)
Length:
9163
CDS:
193..2727

Additional Resources:

NCBI RefSeq record:
NM_004518.6
NBCI Gene record:
KCNQ2 (3785)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004518.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416391 GGACATGCTGTCCCGAATTAA pLKO_005 1836 CDS 100% 15.000 21.000 N KCNQ2 n/a
2 TRCN0000432171 ATCCTGGAAATCGTGACTATC pLKO_005 574 CDS 100% 10.800 15.120 N KCNQ2 n/a
3 TRCN0000044039 CGGAAACCGTTCTGTGTGATT pLKO.1 685 CDS 100% 4.950 6.930 N KCNQ2 n/a
4 TRCN0000044038 CGTGCCCATGTACAGACTTAT pLKO.1 1296 CDS 100% 13.200 9.240 N KCNQ2 n/a
5 TRCN0000430770 TTTCCACCATCAAGGAGTATG pLKO_005 527 CDS 100% 10.800 7.560 N KCNQ2 n/a
6 TRCN0000104865 CCAGGGAATGAACTCTAGTTT pLKO.1 8928 3UTR 100% 5.625 3.938 N Kcnq2 n/a
7 TRCN0000044040 GCTGCAGAATTTCCTCTACAA pLKO.1 420 CDS 100% 4.950 3.465 N KCNQ2 n/a
8 TRCN0000044041 CATGGAGAAGAAGCTGGACTT pLKO.1 2004 CDS 100% 4.050 2.430 N KCNQ2 n/a
9 TRCN0000044042 GCCTGGTACATCGGCTTCCTT pLKO.1 895 CDS 100% 1.000 0.600 N KCNQ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004518.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00904 pDONR223 100% 45.3% 44.5% None (many diffs) n/a
2 ccsbBroad304_00904 pLX_304 0% 45.3% 44.5% V5 (many diffs) n/a
3 TRCN0000471883 GCACTGAAAAAAATGCTCCCACAG pLX_317 38.9% 45.3% 44.5% V5 (many diffs) n/a
Download CSV