Transcript: Mouse XM_017315743.1

PREDICTED: Mus musculus potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnq2 (16536)
Length:
8398
CDS:
195..2924

Additional Resources:

NCBI RefSeq record:
XM_017315743.1
NBCI Gene record:
Kcnq2 (16536)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104866 GCCGTTCTGTGTGATTGATAT pLKO.1 692 CDS 100% 13.200 18.480 N Kcnq2 n/a
2 TRCN0000104867 GTTCTTGGTATCTAAGCGAAA pLKO.1 1754 CDS 100% 4.050 5.670 N Kcnq2 n/a
3 TRCN0000104868 CGTGGTATTCGGTGTTGAGTA pLKO.1 596 CDS 100% 4.950 3.960 N Kcnq2 n/a
4 TRCN0000104865 CCAGGGAATGAACTCTAGTTT pLKO.1 8162 3UTR 100% 5.625 3.938 N Kcnq2 n/a
5 TRCN0000044040 GCTGCAGAATTTCCTCTACAA pLKO.1 422 CDS 100% 4.950 3.465 N KCNQ2 n/a
6 TRCN0000104869 CTTGGATATGTTGTCCCGCAT pLKO.1 1838 CDS 100% 2.160 1.512 N Kcnq2 n/a
7 TRCN0000430770 TTTCCACCATCAAGGAGTATG pLKO_005 529 CDS 100% 10.800 7.560 N KCNQ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00904 pDONR223 100% 37.6% 41% None (many diffs) n/a
2 ccsbBroad304_00904 pLX_304 0% 37.6% 41% V5 (many diffs) n/a
3 TRCN0000471883 GCACTGAAAAAAATGCTCCCACAG pLX_317 38.9% 37.6% 41% V5 (many diffs) n/a
Download CSV