Construct: ORF TRCN0000471911
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012793.1_s317c1
- Derived from:
- ccsbBroadEn_02340
- DNA Barcode:
- GAAAGGTTGAAGAAACATGGACTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SORBS3 (10174)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471911
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10174 | SORBS3 | sorbin and SH3 domain conta... | NM_001018003.3 | 100% | 100% | |
2 | human | 10174 | SORBS3 | sorbin and SH3 domain conta... | XM_005273371.1 | 100% | 100% | |
3 | human | 10174 | SORBS3 | sorbin and SH3 domain conta... | XM_017012944.1 | 100% | 100% | |
4 | human | 10174 | SORBS3 | sorbin and SH3 domain conta... | XM_017012945.1 | 100% | 100% | |
5 | human | 10174 | SORBS3 | sorbin and SH3 domain conta... | XM_017012946.1 | 100% | 100% | |
6 | human | 10174 | SORBS3 | sorbin and SH3 domain conta... | NM_005775.5 | 49% | 49% | 1_1026del |
7 | human | 10174 | SORBS3 | sorbin and SH3 domain conta... | XM_006716266.1 | 46.3% | 46.3% | 1_1143del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1053
- ORF length:
- 987
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgatggagga agccccttcc taggtcggag ggactttgtc tacccttcct 121 caacccgaga ccctagtgcc tctaacggag ggggcagccc agccaggagg gaagagaaga 181 agagaaaggc cgccaggctc aagtttgact tccaggcgca gtcccccaag gagctgactc 241 tgcagaaggg tgacattgtc tacatccaca aggaggtgga caagaactgg ctggagggag 301 agcaccacgg ccgcctgggc atcttccctg ctaattatgt ggaggtgctg cccgcagatg 361 agatccctaa gcccatcaag cccccgacct accaggtgct ggagtatgga gaggctgtgg 421 cccagtacac cttcaagggg gacctggagg tggagctgtc cttccgcaag ggagagcaca 481 tctgcctgat ccgcaaggtg aacgagaact ggtacgaggg acgcatcacg ggcacggggc 541 gccaaggcat attccctgcc agctacgtgc aggtgtctcg tgaaccccgg ctccggctct 601 gtgacgacgg cccccagctc cccacgtctc cccgcctgac cgctgccgcc cgctcagccc 661 gtcaccccag ctcccccTCA GCCCTGCGCA GCCCAGCTGA CCCCATCGAC TTGGGGGGAC 721 AGACCTCCCC CCGTCGCACT GGCTTCTCCT TCCCCACCCA GGAGCCTAGA CCCCAGACCC 781 AGAATCTTGG CACCCCTGGT CCAGCTCTGT CCCACTCTCG AGGTCCCAGC CATCCCCTGG 841 ACCTGGGGAC CTCCTCTCCT AACACCTCTC AGATACACTG GACCCCGTAC CGGGCGATGT 901 ACCAGTACAG GCCCCAGAAC GAAGACGAGC TGGAGCTGCG CGAGGGGGAC AGGGTGGATG 961 TCATGCAGCA GTGTGACGAT GGCTGGTTTG TGGGTGTCTC CCGGAGGACC CAGAAATTCG 1021 GAACGTTCCC TGGAAATTAC GTTGCCCCGG TGTGCCCAAC TTTCTTGTAC AAAGTGGTTG 1081 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1141 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGA 1201 AAGGTTGAAG AAACATGGAC TCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1261 ttgtgaaaga tt