Transcript: Human NM_001018003.3

Homo sapiens sorbin and SH3 domain containing 3 (SORBS3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SORBS3 (10174)
Length:
2270
CDS:
221..1210

Additional Resources:

NCBI RefSeq record:
NM_001018003.3
NBCI Gene record:
SORBS3 (10174)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123148 CGGAACGTTCCCTGGAAATTA pLKO.1 1174 CDS 100% 15.000 21.000 N SORBS3 n/a
2 TRCN0000123144 CCAAATACAGAGGTCTGCTTT pLKO.1 1446 3UTR 100% 4.950 3.465 N SORBS3 n/a
3 TRCN0000123145 GAAGGGTGACATTGTCTACAT pLKO.1 400 CDS 100% 4.950 3.465 N SORBS3 n/a
4 TRCN0000439996 GAGATCCCTAAGCCCATCAAG pLKO_005 515 CDS 100% 4.950 3.465 N SORBS3 n/a
5 TRCN0000442276 TCCGCAAGGTGAACGAGAACT pLKO_005 645 CDS 100% 4.950 3.465 N SORBS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02340 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02340 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471911 GAAAGGTTGAAGAAACATGGACTC pLX_317 38.3% 100% 100% V5 n/a
Download CSV