Transcript: Human NM_005775.5

Homo sapiens sorbin and SH3 domain containing 3 (SORBS3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SORBS3 (10174)
Length:
3227
CDS:
152..2167

Additional Resources:

NCBI RefSeq record:
NM_005775.5
NBCI Gene record:
SORBS3 (10174)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005775.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123148 CGGAACGTTCCCTGGAAATTA pLKO.1 2131 CDS 100% 15.000 21.000 N SORBS3 n/a
2 TRCN0000123146 TGGCTCCAACACCCTTAATTT pLKO.1 274 CDS 100% 15.000 10.500 N SORBS3 n/a
3 TRCN0000123144 CCAAATACAGAGGTCTGCTTT pLKO.1 2403 3UTR 100% 4.950 3.465 N SORBS3 n/a
4 TRCN0000123145 GAAGGGTGACATTGTCTACAT pLKO.1 1357 CDS 100% 4.950 3.465 N SORBS3 n/a
5 TRCN0000439996 GAGATCCCTAAGCCCATCAAG pLKO_005 1472 CDS 100% 4.950 3.465 N SORBS3 n/a
6 TRCN0000442276 TCCGCAAGGTGAACGAGAACT pLKO_005 1602 CDS 100% 4.950 3.465 N SORBS3 n/a
7 TRCN0000123147 CGGCAACATCTTCCAGTGGAA pLKO.1 717 CDS 100% 2.640 1.848 N SORBS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005775.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02340 pDONR223 100% 49% 49% None 1_1026del n/a
2 ccsbBroad304_02340 pLX_304 0% 49% 49% V5 1_1026del n/a
3 TRCN0000471911 GAAAGGTTGAAGAAACATGGACTC pLX_317 38.3% 49% 49% V5 1_1026del n/a
Download CSV