Construct: ORF TRCN0000471969
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001855.1_s317c1
- Derived from:
- ccsbBroadEn_01155
- DNA Barcode:
- GATAATGGTTATAGACATAATCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDK16 (5127)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471969
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5127 | CDK16 | cyclin dependent kinase 16 | NM_006201.5 | 100% | 100% | |
| 2 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_017029570.2 | 100% | 100% | |
| 3 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_017029571.1 | 100% | 100% | |
| 4 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_017029572.2 | 100% | 100% | |
| 5 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_017029573.1 | 100% | 100% | |
| 6 | human | 5127 | CDK16 | cyclin dependent kinase 16 | NM_033018.4 | 98.8% | 98.8% | 1_18del |
| 7 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_011543924.2 | 97.5% | 96.8% | (many diffs) |
| 8 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_011543925.3 | 97.5% | 96.8% | (many diffs) |
| 9 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_011543926.1 | 97.5% | 96.8% | (many diffs) |
| 10 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_011543927.3 | 97.5% | 96.8% | (many diffs) |
| 11 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_011543928.1 | 97.5% | 96.8% | (many diffs) |
| 12 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_011543923.2 | 96.3% | 95.6% | (many diffs) |
| 13 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_017029569.1 | 91.3% | 91.3% | 1_141del |
| 14 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_011543922.1 | 89.8% | 89.1% | (many diffs) |
| 15 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_011543921.1 | 89.1% | 88.5% | (many diffs) |
| 16 | human | 5127 | CDK16 | cyclin dependent kinase 16 | NM_001170460.1 | 87% | 87% | 1_222del |
| 17 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XM_011543920.3 | 85% | 84.3% | (many diffs) |
| 18 | human | 5127 | CDK16 | cyclin dependent kinase 16 | XR_949017.3 | 44.7% | 1_327del;1119_1120ins124;1692_2923del | |
| 19 | mouse | 18555 | Cdk16 | cyclin-dependent kinase 16 | NM_011049.5 | 91.8% | 97.5% | (many diffs) |
| 20 | mouse | 18555 | Cdk16 | cyclin-dependent kinase 16 | XM_006527570.1 | 91.8% | 97.5% | (many diffs) |
| 21 | mouse | 18555 | Cdk16 | cyclin-dependent kinase 16 | XM_017318424.1 | 90.4% | 94.6% | (many diffs) |
| 22 | mouse | 18555 | Cdk16 | cyclin-dependent kinase 16 | NM_001310456.1 | 83.1% | 87.2% | (many diffs) |
| 23 | mouse | 18555 | Cdk16 | cyclin-dependent kinase 16 | XM_017318425.1 | 83.1% | 87.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1554
- ORF length:
- 1488
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tcggatgaag aagatcaaac ggcagctgtc aatgacactc cgaggtggcc 121 gaggcataga caagaccaat ggtgcccctg agcagatagg cctggatgag agtggtggtg 181 gtggcggcag tgaccctgga gaggccccca cacgtgctgc tcctggggaa cttcgttctg 241 cacggggccc actcagctct gcaccagaga ttgtgcacga ggacttgaag atggggtctg 301 atggggagag tgaccaggct tcagccacgt cctcggatga ggtgcagtct ccagtgagag 361 tgcgtatgcg caaccatccc ccacgcaaga tctccactga ggacatcaac aagcgcctat 421 cactaccagc tgacatccgg ctgcctgagg gctacctgga gaagctgacc ctcaatagcc 481 ccatctttga caagcccctc agccgccgcc tccgtcgtgt cagcctatct gagattggct 541 ttgggaaact ggagacctac attaagctgg acaaactggg cgagggtacc tatgccaccg 601 tctacaaagg caaaagcaag ctcacagaca accttgtggc actcaaggag atcagactgg 661 aacatgaaga gggggcaccc tgcaccgcca tccgggaagt gtccctgctc aaggacctca 721 aacacgccaa catcgttacg ctacatgaca ttatccacac ggagaagtcc ctcacccttg 781 tctttgagta cctggacaag gacctgaagc agtacctgga tgactgtggg aacatcatca 841 acatgcacaa cgtgaaactg ttcctgttcc agctgctccg tggcctggcc tactgccacc 901 ggcagaaggt gctacaccga gacctcaagc cccagaacct gctcatcaac gagaggggag 961 agctcaagct ggctgacttt ggcctggccc gagccaagtc aatcccaaca aagacatact 1021 ccaatgaggt ggtgacactg tggtaccggc cccctgacat cctgcttggg tcCACGGACT 1081 ACTCCACTCA GATTGACATG TGGGGTGTGG GCTGCATCTT CTATGAGATG GCCACAGGCC 1141 GTCCCCTCTT TCCGGGCTCC ACGGTGGAGG AACAGCTACA CTTCATCTTC CGTATCTTAG 1201 GAACCCCAAC TGAGGAGACG TGGCCAGGCA TCCTGTCCAA CGAGGAGTTC AAGACATACA 1261 ACTACCCCAA GTACCGAGCC GAGGCCCTTT TGAGCCACGC ACCCCGACTT GATAGCGACG 1321 GGGCCGACCT CCTCACCAAG CTGTTGCAGT TTGAGGGTCG AAATCGGATC TCCGCAGAGG 1381 ATGCCATGAA ACATCCATTC TTCCTCAGTC TGGGGGAGCG GATCCACAAA CTTCCTGACA 1441 CTACTTCCAT ATTTGCACTA AAGGAGATTC AGCTACAAAA GGAGGCCAGC CTTCGGTCTT 1501 CGTCGATGCC TGACTCAGGC AGGCCAGCTT TCCGCGTGGT GGACACCGAG TTCTACCCAA 1561 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1621 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1681 TATCTTGTGG AAAGGACGAG ATAATGGTTA TAGACATAAT CGTACGCGTT AAGTCgacaa 1741 tcaacctctg gattacaaaa tttgtgaaag att