Transcript: Mouse NM_001310456.1

Mus musculus cyclin-dependent kinase 16 (Cdk16), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cdk16 (18555)
Length:
3281
CDS:
651..2036

Additional Resources:

NCBI RefSeq record:
NM_001310456.1
NBCI Gene record:
Cdk16 (18555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023076 CGAGGCATAGATAAGACCAAT pLKO.1 469 5UTR 100% 4.950 6.930 N Cdk16 n/a
2 TRCN0000023078 GCCAACATCGTCACACTACAT pLKO.1 1206 CDS 100% 4.950 6.930 N Cdk16 n/a
3 TRCN0000319699 GCCAACATCGTCACACTACAT pLKO_005 1206 CDS 100% 4.950 6.930 N Cdk16 n/a
4 TRCN0000023075 CGAGTCAGTTTGTCTGAGATT pLKO.1 996 CDS 100% 4.950 3.960 N Cdk16 n/a
5 TRCN0000319761 CGAGTCAGTTTGTCTGAGATT pLKO_005 996 CDS 100% 4.950 3.960 N Cdk16 n/a
6 TRCN0000023077 GCACTAAAGGAGGTACAGCTA pLKO.1 1935 CDS 100% 2.640 2.112 N Cdk16 n/a
7 TRCN0000319762 GCACTAAAGGAGGTACAGCTA pLKO_005 1935 CDS 100% 2.640 2.112 N Cdk16 n/a
8 TRCN0000023074 GCCAAGTCAATTCCTACTAAA pLKO.1 1473 CDS 100% 13.200 9.240 N Cdk16 n/a
9 TRCN0000319700 GCCAAGTCAATTCCTACTAAA pLKO_005 1473 CDS 100% 13.200 9.240 N Cdk16 n/a
10 TRCN0000196804 GCAATATCTCTGTATACAGAC pLKO.1 2601 3UTR 100% 4.050 2.835 N CDK16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11022 pDONR223 100% 88.2% 91.7% None (many diffs) n/a
2 ccsbBroad304_11022 pLX_304 0% 88.2% 91.7% V5 (many diffs) n/a
3 TRCN0000473400 TCCTTCCCTGAATCACTGGTACTA pLX_317 41.2% 88.2% 91.7% V5 (many diffs) n/a
4 ccsbBroadEn_01155 pDONR223 100% 83.1% 87.2% None (many diffs) n/a
5 ccsbBroad304_01155 pLX_304 0% 83.1% 87.2% V5 (many diffs) n/a
6 TRCN0000471969 GATAATGGTTATAGACATAATCGT pLX_317 32.6% 83.1% 87.2% V5 (many diffs) n/a
7 ccsbBroadEn_06698 pDONR223 100% 83% 87.2% None (many diffs) n/a
8 ccsbBroad304_06698 pLX_304 0% 83% 87.2% V5 (many diffs) n/a
9 TRCN0000471737 CCAATCAACCGGGCCCCGAAACTC pLX_317 4.1% 83% 87.2% V5 (many diffs) n/a
10 ccsbBroadEn_14730 pDONR223 0% 83% 87.2% None (many diffs) n/a
11 ccsbBroad304_14730 pLX_304 0% 83% 87.2% V5 (many diffs) n/a
12 TRCN0000470260 TTAACTTACATAATTTAAGGATTG pLX_317 25.1% 83% 87.2% V5 (many diffs) n/a
13 TRCN0000489123 TGATCAGTTCGAGGTAGGCTTTCC pLX_317 25% 83% 87.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV