Construct: ORF TRCN0000471981
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014216.1_s317c1
- Derived from:
- ccsbBroadEn_12935
- DNA Barcode:
- TAGCCGCTGCACCAATTTCGCGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OTULIN (90268)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471981
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | XM_017010015.1 | 89.5% | 89.5% | 0_1ins93 |
| 2 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | NM_138348.6 | 84.6% | 84.6% | 1_162del |
| 3 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | XM_011514151.2 | 84.6% | 84.6% | 1_162del |
| 4 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | XM_011514152.2 | 84.6% | 84.6% | 1_162del |
| 5 | human | 90268 | OTULIN | OTU deubiquitinase with lin... | XM_011514154.2 | 59% | 59% | 1_162del;592_593ins270 |
| 6 | mouse | 432940 | Otulin | OTU deubiquitinase with lin... | XM_006520104.1 | 79.1% | 82.7% | (many diffs) |
| 7 | mouse | 432940 | Otulin | OTU deubiquitinase with lin... | XM_006520105.1 | 78.3% | 81.8% | (many diffs) |
| 8 | mouse | 432940 | Otulin | OTU deubiquitinase with lin... | NM_001013792.2 | 74.4% | 77.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 960
- ORF length:
- 894
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaat 61 ttggcatgta ccgtgctgca gatgaaatag aaaaggagaa agaattgctt atacatgaaa 121 gaggggcatc agaaccgaga ttaagcgtag ctcctgaaat ggatatcatg gactactgca 181 aaaaagaatg gagaggaaat acacagaaag caacgtgtat gaaaatgggc tatgaagagg 241 tttctcagaa gttcacctcc atacggcgag tccgtggtga taattactgt gcactgaggg 301 ccacgctgtt ccaggccatg agccaggctg tggggctgcc gccctggctg caggacccgg 361 agctcatgct gttaccagaa aaactcataa gcaaatacaa ctggatcaag caatggaaac 421 ttggactgaa atttgatggg aagaatgagg acctggttga taaaattaaa gagtccctta 481 ctctgctgag gaagaagtgg gCAGGCTTGG CTGAAATGAG AACTGCTGAA GCAAGACAGA 541 TAGCTTGTGA TGAACTATTC ACAAATGAGG CGGAGGAATA TAGCCTCTAT GAAGCTGTAA 601 AATTTCTAAT GCTAAACAGA GCCATTGAAC TATATAATGA TAAAGAGAAA GGAAAGGAAG 661 TACCATTTTT CTCTGTGCTT CTGTTTGCTC GGGACACATC AAATGACCCA GGACAGCTTC 721 TGAGGAACCA CCTCAACCAG GTGGGACACA CTGGTGGTCT TGAACAGGTT GAAATGTTCC 781 TTCTTGCCTA TGCTGTGCGC CACACCATCC AGGTGTACCG GCTCTCCAAG TACAACACGG 841 AAGAATTCAT CACAGTCTAC CCCACCGACC CACCCAAGGA CTGGCCAGTG GTAACGCTCA 901 TTGCTGAGGA CGATCGGCAC TATAACATCC CCGTCAGAGT GTGTGAGGAG ACCAGTCTAT 961 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1021 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1081 TTTATATATC TTGTGGAAAG GACGATAGCC GCTGCACCAA TTTCGCGCCA CGCGTTAAGT 1141 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt