Transcript: Human XM_011514152.2

PREDICTED: Homo sapiens OTU deubiquitinase with linear linkage specificity (OTULIN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OTULIN (90268)
Length:
5155
CDS:
4033..5091

Additional Resources:

NCBI RefSeq record:
XM_011514152.2
NBCI Gene record:
OTULIN (90268)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275466 ACAGAGCCATTGAACTATATA pLKO_005 4745 CDS 100% 15.000 10.500 N OTULIN n/a
2 TRCN0000275410 GGCATCAGAACCGAGATTAAG pLKO_005 4254 CDS 100% 13.200 9.240 N OTULIN n/a
3 TRCN0000135940 GTGGTCTTGAACAGGTTGAAA pLKO.1 4883 CDS 100% 5.625 3.938 N OTULIN n/a
4 TRCN0000135471 GCAATGGAAACTTGGACTGAA pLKO.1 4539 CDS 100% 4.950 3.465 N OTULIN n/a
5 TRCN0000275409 GCAATGGAAACTTGGACTGAA pLKO_005 4539 CDS 100% 4.950 3.465 N OTULIN n/a
6 TRCN0000134469 GAAATGTTCCTTCTTGCCTAT pLKO.1 4900 CDS 100% 4.050 2.835 N OTULIN n/a
7 TRCN0000134518 GAACAGGTTGAAATGTTCCTT pLKO.1 4891 CDS 100% 0.300 0.210 N OTULIN n/a
8 TRCN0000285391 GAACAGGTTGAAATGTTCCTT pLKO_005 4891 CDS 100% 0.300 0.210 N OTULIN n/a
9 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 852 5UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12935 pDONR223 100% 84.6% 84.6% None 1_162del n/a
2 ccsbBroad304_12935 pLX_304 0% 84.6% 84.6% V5 1_162del n/a
3 TRCN0000471981 TAGCCGCTGCACCAATTTCGCGCC pLX_317 51.3% 84.6% 84.6% V5 1_162del n/a
4 ccsbBroadEn_12936 pDONR223 100% 60.7% 60.7% None 1_414del n/a
5 ccsbBroad304_12936 pLX_304 0% 60.7% 60.7% V5 1_414del n/a
6 TRCN0000475487 CTCTTATATACGTTTCCCCCTAAT pLX_317 33% 60.7% 60.7% V5 1_414del n/a
Download CSV