Construct: ORF TRCN0000472003
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008095.1_s317c1
- Derived from:
- ccsbBroadEn_00960
- DNA Barcode:
- AGTTCCTACGCTAATACATGCCTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SMAD1 (4086)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472003
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4086 | SMAD1 | SMAD family member 1 | NM_001003688.1 | 100% | 100% | |
| 2 | human | 4086 | SMAD1 | SMAD family member 1 | NM_001354811.1 | 100% | 100% | |
| 3 | human | 4086 | SMAD1 | SMAD family member 1 | NM_001354812.1 | 100% | 100% | |
| 4 | human | 4086 | SMAD1 | SMAD family member 1 | NM_001354813.1 | 100% | 100% | |
| 5 | human | 4086 | SMAD1 | SMAD family member 1 | NM_001354814.1 | 100% | 100% | |
| 6 | human | 4086 | SMAD1 | SMAD family member 1 | NM_001354816.1 | 100% | 100% | |
| 7 | human | 4086 | SMAD1 | SMAD family member 1 | NM_001354817.1 | 100% | 100% | |
| 8 | human | 4086 | SMAD1 | SMAD family member 1 | NM_005900.3 | 100% | 100% | |
| 9 | human | 4086 | SMAD1 | SMAD family member 1 | XM_011531962.2 | 100% | 100% | |
| 10 | human | 4086 | SMAD1 | SMAD family member 1 | XM_011531964.2 | 100% | 100% | |
| 11 | mouse | 17125 | Smad1 | SMAD family member 1 | NM_008539.3 | 88.9% | 99.1% | (many diffs) |
| 12 | mouse | 17125 | Smad1 | SMAD family member 1 | XM_006530746.3 | 88.9% | 99.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1461
- ORF length:
- 1395
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tgtgacaagt ttattttcct ttacaagtcc agctgtgaag agacttcttg 121 ggtggaaaca gggcgatgaa gaagaaaaat gggcagagaa agctgttgat gctttggtga 181 aaaaactgaa gaaaaagaaa ggtgccatgg aggaactgga aaaggccttg agctgcccag 241 ggcaaccgag taactgtgtc accattcccc gctctctgga tggcaggctg caagtctccc 301 accggaaggg actgcctcat gtcatttact gccgtgtgtg gcgctggccc gatcttcaga 361 gccaccatga actaaaacca ctggaatgct gtgagtttcc ttttggttcc aagcagaagg 421 aggtctgcat caatccctac cactataaga gagtagaaag ccctgtactt cctcctgtgc 481 tggttccaag acacagcgaa tataatcctc agcacagcct cttagctcag ttccgtaact 541 taggacaaaa tgagcctcac atgccactca acgccacttt tccagattct ttccagcaac 601 ccaacagcca cccgtttcct cactctccca atagcagtta cccaaactct cctgggagca 661 gcagcagcac ctaccctcac tctcccacca gctcagaccc aggaagccct ttccagatgc 721 cagctgatac gcccccacct gcttacctgc ctcctgaaga ccccatgacc caggatggct 781 ctcagccgat ggacacaaac atgatggcgc ctcccctgcc ctcagaaatc aacagaggag 841 atgttcaggc ggttgcttat gaggaaccaa aacactggtg ctctattgtc tactatgagc 901 tcaacaatcg tgtgggtgaa gcgttccatg cctcctccac aagtgtgttg gtggatggtt 961 tcactgatcc ttccaacaat aagaaccgtt tctgccttgg gctgctctcc aatgttaacc 1021 ggaattccac tattgaaaac accaggcggc atattggaaa aggagttcat ctttattatg 1081 ttggagggga ggtgtatgcc gaatgcctta gtgacagtag catctttgtg caaagtcgga 1141 actgcaacta ccatcatgga tttcatccta ctactgtttg caagatccct agtgggtgta 1201 gtctgaaaat ttttaacaac caagaatttg ctcagttatt ggcacagtct gtgaaccatg 1261 gatttgagac agtctatgag cttacaaaaa tgtgtactat acgtatgagc tttgtgaagg 1321 gctggggagc agaataccac cgccaggatg ttactagcac cccctgctgg attgagatac 1381 atcTGCACGG CCCCCTCCAG TGGCTGGATA AAGTTCTTAC TCAAATGGGT TCACCTCATA 1441 ATCCTATTTC ATCTGTATCT TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1501 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1561 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAGTT CCTACGCTAA 1621 TACATGCCTT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt