Transcript: Human NM_001354812.1

Homo sapiens SMAD family member 1 (SMAD1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
SMAD1 (4086)
Length:
2911
CDS:
272..1669

Additional Resources:

NCBI RefSeq record:
NM_001354812.1
NBCI Gene record:
SMAD1 (4086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425719 ACGGTCCTAAGAGATTCTTTG pLKO_005 1988 3UTR 100% 10.800 15.120 N SMAD1 n/a
2 TRCN0000432716 ACTGATCCTTCCAACAATAAG pLKO_005 1169 CDS 100% 13.200 9.240 N SMAD1 n/a
3 TRCN0000021781 CACCTCATAATCCTATTTCAT pLKO.1 1638 CDS 100% 5.625 3.938 N SMAD1 n/a
4 TRCN0000021783 CCAGCTGTGAAGAGACTTCTT pLKO.1 305 CDS 100% 4.950 3.465 N SMAD1 n/a
5 TRCN0000021780 CCTTAGTGACAGTAGCATCTT pLKO.1 1312 CDS 100% 4.950 3.465 N SMAD1 n/a
6 TRCN0000021782 GCCGATGGACACAAACATGAT pLKO.1 991 CDS 100% 4.950 3.465 N SMAD1 n/a
7 TRCN0000021779 CGGTTGCTTATGAGGAACCAA pLKO.1 1056 CDS 100% 3.000 2.100 N SMAD1 n/a
8 TRCN0000423087 GTTCCAAGACACAGCGAATAT pLKO_005 689 CDS 100% 13.200 7.920 N SMAD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00960 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00960 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472003 AGTTCCTACGCTAATACATGCCTT pLX_317 6.2% 100% 100% V5 n/a
Download CSV