Transcript: Mouse NM_008539.3

Mus musculus SMAD family member 1 (Smad1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Smad1 (17125)
Length:
3133
CDS:
398..1795

Additional Resources:

NCBI RefSeq record:
NM_008539.3
NBCI Gene record:
Smad1 (17125)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025876 GCCGAGTAACTGCGTCACCAT pLKO.1 577 CDS 100% 0.880 1.232 N Smad1 n/a
2 TRCN0000025910 ACCGTGTATGAACTCACCAAA pLKO.1 1601 CDS 100% 4.950 3.960 N Smad1 n/a
3 TRCN0000277448 ACCGTGTATGAACTCACCAAA pLKO_005 1601 CDS 100% 4.950 3.960 N Smad1 n/a
4 TRCN0000025933 TCCTATTTCATCCGTGTCTTA pLKO.1 1774 CDS 100% 4.950 3.960 N Smad1 n/a
5 TRCN0000285960 TCCTATTTCATCCGTGTCTTA pLKO_005 1774 CDS 100% 4.950 3.960 N Smad1 n/a
6 TRCN0000277377 GACGAAGGAGCCACGATAATA pLKO_005 1879 3UTR 100% 15.000 10.500 N Smad1 n/a
7 TRCN0000277449 GGACTACCTCATGTCATTTAT pLKO_005 641 CDS 100% 15.000 10.500 N Smad1 n/a
8 TRCN0000025963 TGGTGCTCTATTGTGTACTAT pLKO.1 1208 CDS 100% 5.625 3.938 N Smad1 n/a
9 TRCN0000277450 TGGTGCTCTATTGTGTACTAT pLKO_005 1208 CDS 100% 5.625 3.938 N Smad1 n/a
10 TRCN0000025884 CCCATTTGGTTCCAAGCAGAA pLKO.1 730 CDS 100% 4.050 2.835 N Smad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00960 pDONR223 100% 88.9% 99.1% None (many diffs) n/a
2 ccsbBroad304_00960 pLX_304 0% 88.9% 99.1% V5 (many diffs) n/a
3 TRCN0000472003 AGTTCCTACGCTAATACATGCCTT pLX_317 6.2% 88.9% 99.1% V5 (many diffs) n/a
Download CSV