Construct: ORF TRCN0000472024
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003453.1_s317c1
- Derived from:
- ccsbBroadEn_02239
- DNA Barcode:
- CCTCTAGCTTAATACGCTCCCAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RASSF2 (9770)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472024
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9770 | RASSF2 | Ras association domain fami... | NM_014737.3 | 100% | 100% | |
| 2 | human | 9770 | RASSF2 | Ras association domain fami... | NM_170774.1 | 100% | 100% | |
| 3 | human | 9770 | RASSF2 | Ras association domain fami... | XM_005260895.3 | 100% | 100% | |
| 4 | human | 9770 | RASSF2 | Ras association domain fami... | XM_017028150.1 | 100% | 100% | |
| 5 | human | 9770 | RASSF2 | Ras association domain fami... | XM_017028151.1 | 100% | 100% | |
| 6 | human | 9770 | RASSF2 | Ras association domain fami... | XM_017028152.1 | 100% | 100% | |
| 7 | human | 9770 | RASSF2 | Ras association domain fami... | XM_017028153.1 | 100% | 100% | |
| 8 | human | 9770 | RASSF2 | Ras association domain fami... | XM_011529410.1 | 99.3% | 99% | 377_382delGTACAT |
| 9 | human | 9770 | RASSF2 | Ras association domain fami... | XM_011529411.1 | 99.3% | 99% | 377_382delGTACAT |
| 10 | human | 9770 | RASSF2 | Ras association domain fami... | XM_011529412.2 | 99.3% | 99% | 377_382delGTACAT |
| 11 | human | 9770 | RASSF2 | Ras association domain fami... | XM_017028149.1 | 99.3% | 99% | 377_382delGTACAT |
| 12 | mouse | 215653 | Rassf2 | Ras association (RalGDS/AF-... | NM_175445.4 | 86.7% | 92.6% | (many diffs) |
| 13 | mouse | 215653 | Rassf2 | Ras association (RalGDS/AF-... | XM_006499139.3 | 86.7% | 92.6% | (many diffs) |
| 14 | mouse | 215653 | Rassf2 | Ras association (RalGDS/AF-... | XM_006499140.3 | 86.7% | 92.6% | (many diffs) |
| 15 | mouse | 215653 | Rassf2 | Ras association (RalGDS/AF-... | XM_006499141.2 | 86.7% | 92.6% | (many diffs) |
| 16 | mouse | 215653 | Rassf2 | Ras association (RalGDS/AF-... | XM_006499142.2 | 86.7% | 92.6% | (many diffs) |
| 17 | mouse | 215653 | Rassf2 | Ras association (RalGDS/AF-... | XM_006499143.3 | 86.7% | 92.6% | (many diffs) |
| 18 | mouse | 215653 | Rassf2 | Ras association (RalGDS/AF-... | XM_006499144.3 | 86.7% | 92.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1047
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggactacagc caccaaacgt ccctagtccc atgtggacaa gataaataca 121 tttccaaaaa tgaacttctc ttgcatctga agacctacaa cttgtactat gaaggccaga 181 atttacagct ccggcaccgg gaggaagaag acgagttcat tgtggagggg ctcctgaaca 241 tctcctgggg cctgcgccgg cccattcgcc tgcagatgca ggatgacaac gaacgcattc 301 gaccccctcc atcctcctcc tcctggcact ctggctgtaa cctgggggct cagggaacca 361 ctctgaagcc cctgactgtg cccaaagttc agatctcaga ggtggatgcc ccgccggagg 421 gtgaccagat gccaagctcc acagactcca ggggcctgaa gcccctgcag gaggacaccc 481 cacagctgat gcgcacacgc agtgatgttg gggtgcgtcg ccgtggcaat gtgaggacgc 541 ctagtgacca gcggcgaatc agacgccacc gcttctccat caacggccat ttctacaacc 601 ataagacatc cgtgttcaca ccagccTATG GCTCTGTCAC CAACGTCCGC ATCAACAGCA 661 CCATGACCAC CCCACAGGTC CTGAAGCTGC TGCTCAACAA ATTTAAGATT GAGAATTCAG 721 CAGAGGAGTT TGCCTTGTAC GTGGTCCATA CGAGTGGTGA GAAACAGAAG CTGAAGGCCA 781 CCGATTACCC GCTGATTGCC CGAATCCTCC AGGGCCCATG TGAGCAGATC TCCAAAGTGT 841 TCCTAATGGA GAAGGACCAG GTGGAGGAAG TCACCTACGA CGTGGCCCAG TATATAAAGT 901 TCGAGATGCC GGTACTTAAA AGCTTCATTC AGAAGCTCCA GGAGGAAGAA GATCGGGAAG 961 TAAAGAAGCT GATGCGCAAG TACACCGTGC TCCGGCTAAT GATTCGACAG AGGCTGGAGG 1021 AGATAGCCGA GACCCCAGCA ACAATCTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 1081 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCTGT 1141 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACCTCTAGC 1201 TTAATACGCT CCCAGTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1261 aagatt