Transcript: Mouse XM_006499141.2

PREDICTED: Mus musculus Ras association (RalGDS/AF-6) domain family member 2 (Rassf2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rassf2 (215653)
Length:
4636
CDS:
122..1102

Additional Resources:

NCBI RefSeq record:
XM_006499141.2
NBCI Gene record:
Rassf2 (215653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434612 GTACACTGTGCTCCGGCTAAT pLKO_005 1033 CDS 100% 10.800 15.120 N Rassf2 n/a
2 TRCN0000077645 CCAGTATATAAAGTTCGAGAT pLKO.1 940 CDS 100% 4.050 5.670 N Rassf2 n/a
3 TRCN0000077643 CCCGTTATCTTTATCTTGAAT pLKO.1 2929 3UTR 100% 5.625 4.500 N Rassf2 n/a
4 TRCN0000420986 CTCTCTGATGTTCTTACATTT pLKO_005 1420 3UTR 100% 13.200 9.240 N Rassf2 n/a
5 TRCN0000444452 CGCATACGCAAGTGTGCATAT pLKO_005 1376 3UTR 100% 10.800 7.560 N Rassf2 n/a
6 TRCN0000077646 CCATGCGGACAAGACAAGTAT pLKO.1 152 CDS 100% 5.625 3.938 N Rassf2 n/a
7 TRCN0000428725 CAACAAGTTTAAGATTGAGAA pLKO_005 748 CDS 100% 4.950 3.465 N Rassf2 n/a
8 TRCN0000077889 GAAGACCTACAACTTGTACTA pLKO.1 202 CDS 100% 4.950 3.465 N RASSF2 n/a
9 TRCN0000077647 GAAGTGGATATGCCAGTTGAA pLKO.1 452 CDS 100% 4.950 3.465 N Rassf2 n/a
10 TRCN0000077891 TCTGAAGACCTACAACTTGTA pLKO.1 199 CDS 100% 4.950 2.970 N RASSF2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3317 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02239 pDONR223 100% 86.7% 92.6% None (many diffs) n/a
2 ccsbBroad304_02239 pLX_304 0% 86.7% 92.6% V5 (many diffs) n/a
3 TRCN0000472024 CCTCTAGCTTAATACGCTCCCAGT pLX_317 43% 86.7% 92.6% V5 (many diffs) n/a
Download CSV