Construct: ORF TRCN0000472038
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008868.1_s317c1
- Derived from:
- ccsbBroadEn_16013
- DNA Barcode:
- CATCCCAAACACCCTAGCGGAGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DOCK8 (81704)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472038
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | XM_011518049.2 | 33.9% | 33.9% | 1_2994del;3154C>T;3669G>A |
| 2 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | NM_001190458.2 | 25.6% | 25.6% | 1_4458del;4618C>T;5133G>A |
| 3 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | XM_011518045.3 | 25.6% | 25.6% | 1_4458del;4618C>T;5133G>A |
| 4 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | NM_001193536.1 | 25.2% | 25.2% | 1_4554del;4714C>T;5229G>A |
| 5 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | XM_011518047.3 | 25.2% | 25.2% | 1_4554del;4714C>T;5229G>A |
| 6 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | XM_011518048.2 | 25.2% | 25.2% | 1_4554del;4714C>T;5229G>A |
| 7 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | XM_017015173.1 | 25.2% | 25.2% | 1_4554del;4714C>T;5229G>A |
| 8 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | XM_011518046.2 | 24.9% | 24.9% | 1_4620del;4780C>T;5295G>A |
| 9 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | XM_017015174.1 | 24.9% | 24.9% | 1_4620del;4780C>T;5295G>A |
| 10 | human | 81704 | DOCK8 | dedicator of cytokinesis 8 | NM_203447.3 | 24.4% | 24.4% | 1_4758del;4918C>T;5433G>A |
| 11 | mouse | 76088 | Dock8 | dedicator of cytokinesis 8 | XM_006527435.3 | 22.2% | 23.9% | (many diffs) |
| 12 | mouse | 76088 | Dock8 | dedicator of cytokinesis 8 | XM_011247397.2 | 22.2% | 23.9% | (many diffs) |
| 13 | mouse | 76088 | Dock8 | dedicator of cytokinesis 8 | NM_028785.3 | 21.5% | 23.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1605
- ORF length:
- 1539
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gatgactcct tttcccaccc aggtggagga acttctctgt aatctgaata 121 gcatcttata tgacacagtg aaaatgaggg aatttcagga agatcctgag atgcttatgg 181 atctcatgta cagaattgcc aagagttacc aggcatctcc tgatttgcgg ctgacctggc 241 tccagaacat ggcagagaaa cacaccaaga agaagtgcta cacggaggct gccatgtgcc 301 tggtgcacgc cgctgcgtta gtggctgagt atctgagcat gctggaggac cacagctacc 361 tgcccgtggg cagtgtcagc ttccagaata tttcttccaa tgtgctggag gagtctgtgg 421 tctctgagga caccctgtca cctgacgagg atggggtgtg cgcaggccag tacttcaccg 481 agagtggcct ggtaggcctc ctggagcagg ccgcggagct cttcagcacg ggaggcttat 541 atgagacagt taatgaggtc tacaagctgg tcatccccat cctagaagcg catcgagaat 601 tccggaagct gacactcact cacagcaagc tgcagagagc cttcgacagc atcgttaaca 661 aggatcataa gagaatgttt ggaacctact tccgagttgg tttctttgga tccaaatttg 721 gggatttgga tgaacaggaa tttgtctaca aagagcctgc aattaccaag cttcctgaga 781 tctcacatag actagaggca ttttatggtc aatgttttgg tgcagaattt gtggaagtga 841 ttaaagactc cactcctgtg gacaaaacca agttggatcc taacaaggcc tacatacaga 901 tcacttttgt ggagccctac tttgatgagt atgagatgaa agacagggtc acatactttg 961 agaagaattt caacctccgg aggttcatgt acaccacccc gttcaccctg gaggggcggc 1021 ctcggggaga gctgcatgag cagtacagaa ggaacacagt cctgaccact atgcacgcct 1081 tcccctacat caagaccagg atcagcgTCA TCCAGAAGGA GGAGTTTGTT TTGACACCGA 1141 TTGAAGTTGC CATTGAAGAC ATGAAGAAGA AGACCCTGCA GTTAGCAGTT GCCATTAACC 1201 AGGAGCCGCC TGATGCAAAG ATGCTTCAGA TGGTGCTGCA AGGCTCTGTG GGAGCTACTG 1261 TAAATCAGGG ACCACTGGAA GTAGCCCAAG TGTTTTTGGC TGAAATTCCT GCTGATCCAA 1321 AACTCTATCG ACATCACAAC AAGTTGAGGT TATGCTTTAA GGAATTCATC ATGAGATGTG 1381 GTGAAGCTGT AGAGAAAAAC AAGCGTCTCA TCACGGCAGA CCAGAGGGAA TATCAGCAGG 1441 AACTCAAAAA GAACTATAAC AAGCTAAAAG AGAACCTCAG GCCAATGATC GAGCGGAAAA 1501 TTCCAGAACT GTACAAGCCA ATATTCAGAG TTGAGAGTCA AAAGAGGGAC TCCTTCCACA 1561 GATCTAGTTT CAGGAAATGT GAAACCCAGT TGTCACAGGG CAGCTACCCA ACTTTCTTGT 1621 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1681 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1741 GAAAGGACGA CATCCCAAAC ACCCTAGCGG AGCCACGCGT TAAGTCgaca atcaacctct 1801 ggattacaaa atttgtgaaa gatt