Transcript: Human XM_011518048.2

PREDICTED: Homo sapiens dedicator of cytokinesis 8 (DOCK8), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOCK8 (81704)
Length:
7273
CDS:
137..6232

Additional Resources:

NCBI RefSeq record:
XM_011518048.2
NBCI Gene record:
DOCK8 (81704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122958 GCCCTCTACGATGTTAAAGAA pLKO.1 797 CDS 100% 5.625 7.875 N DOCK8 n/a
2 TRCN0000137254 GCCCTCTACGATGTTAAAGAA pLKO.1 797 CDS 100% 5.625 7.875 N DOCK8 n/a
3 TRCN0000122955 GCCAAAGGAATGTAGGACTTT pLKO.1 220 CDS 100% 4.950 6.930 N DOCK8 n/a
4 TRCN0000122954 GCAAACTTGTAGGAGTACGAA pLKO.1 6677 3UTR 100% 3.000 4.200 N DOCK8 n/a
5 TRCN0000137183 GCAAACTTGTAGGAGTACGAA pLKO.1 6677 3UTR 100% 3.000 4.200 N DOCK8 n/a
6 TRCN0000137279 CCTACCTTTAGTTGGCATCAT pLKO.1 3577 CDS 100% 4.950 3.960 N DOCK8 n/a
7 TRCN0000136786 CGAGTTAGATCAAGAAGCCTT pLKO.1 4183 CDS 100% 2.640 2.112 N DOCK8 n/a
8 TRCN0000122956 GCTTGCTAAGACTGGAGATTT pLKO.1 1449 CDS 100% 13.200 9.240 N DOCK8 n/a
9 TRCN0000138603 CAGGGCAAACTTGTAGGAGTA pLKO.1 6673 3UTR 100% 4.050 2.835 N DOCK8 n/a
10 TRCN0000138624 CCAAATGGACTCTGACCAGAT pLKO.1 6394 3UTR 100% 4.050 2.835 N DOCK8 n/a
11 TRCN0000122957 GCACGTACATAACATGGACAA pLKO.1 2920 CDS 100% 4.050 2.835 N DOCK8 n/a
12 TRCN0000137238 GCACGTACATAACATGGACAA pLKO.1 2920 CDS 100% 4.050 2.835 N DOCK8 n/a
13 TRCN0000137718 GCTGTGGAAATACGTCCAGTA pLKO.1 680 CDS 100% 4.050 2.835 N DOCK8 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 68 5UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 68 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467054 AGTCATTATCCACTGCTTCTACTG pLX_317 6.7% 98.1% 97.9% V5 (many diffs) n/a
2 ccsbBroadEn_16013 pDONR223 0% 25.2% 25.2% None 1_4554del;4714C>T;5229G>A n/a
3 ccsbBroad304_16013 pLX_304 0% 25.2% 25.2% V5 1_4554del;4714C>T;5229G>A n/a
4 TRCN0000472038 CATCCCAAACACCCTAGCGGAGCC pLX_317 32.5% 25.2% 25.2% V5 1_4554del;4714C>T;5229G>A n/a
Download CSV