Transcript: Mouse NM_028785.3

Mus musculus dedicator of cytokinesis 8 (Dock8), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Dock8 (76088)
Length:
7810
CDS:
123..6425

Additional Resources:

NCBI RefSeq record:
NM_028785.3
NBCI Gene record:
Dock8 (76088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028785.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241450 GACTATGTGCCGTCTAGTTAT pLKO_005 6955 3UTR 100% 13.200 18.480 N Dock8 n/a
2 TRCN0000241446 GGCTTGTACGAGACGGTTAAT pLKO_005 5352 CDS 100% 13.200 18.480 N Dock8 n/a
3 TRCN0000241447 TTGCCCTCTATGACGTTAAAG pLKO_005 988 CDS 100% 13.200 18.480 N Dock8 n/a
4 TRCN0000241449 GACCGGTTTCCAGGCATAAAT pLKO_005 4284 CDS 100% 15.000 12.000 N Dock8 n/a
5 TRCN0000215865 CAGCTATTACATACCATAATA pLKO.1 1972 CDS 100% 1.500 1.200 N Dock8 n/a
6 TRCN0000241448 GCAGCCGGATGTCTTACTATT pLKO_005 2920 CDS 100% 13.200 9.240 N Dock8 n/a
7 TRCN0000191834 GCTTCAAAGATGACATAACTA pLKO.1 3169 CDS 100% 5.625 3.938 N Dock8 n/a
8 TRCN0000202130 CCTGGATAAACGGGACAGTTT pLKO.1 3125 CDS 100% 4.950 3.465 N Dock8 n/a
9 TRCN0000137718 GCTGTGGAAATACGTCCAGTA pLKO.1 873 CDS 100% 4.050 2.835 N DOCK8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028785.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467054 AGTCATTATCCACTGCTTCTACTG pLX_317 6.7% 82.8% 87.2% V5 (many diffs) n/a
2 ccsbBroadEn_16013 pDONR223 0% 21.5% 23.1% None (many diffs) n/a
3 ccsbBroad304_16013 pLX_304 0% 21.5% 23.1% V5 (many diffs) n/a
4 TRCN0000472038 CATCCCAAACACCCTAGCGGAGCC pLX_317 32.5% 21.5% 23.1% V5 (many diffs) n/a
Download CSV