Construct: ORF TRCN0000472050
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004012.1_s317c1
- Derived from:
- ccsbBroadEn_08261
- DNA Barcode:
- TCTACCTATGACCGTTGAGTTGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NT5C3A (51251)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472050
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001166118.3 | 99.5% | 99.6% | 0_1insATG;240T>C |
| 2 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001356996.2 | 99.5% | 99.6% | 0_1insATG;240T>C |
| 3 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374336.1 | 99.5% | 99.6% | 0_1insATG;240T>C |
| 4 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374337.1 | 99.5% | 99.6% | 0_1insATG;240T>C |
| 5 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001002009.3 | 96.1% | 96.2% | 1_33del;276T>C |
| 6 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_016489.13 | 96.1% | 96.2% | 1_33del;276T>C |
| 7 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374339.1 | 89.6% | 89.5% | (many diffs) |
| 8 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001002010.4 | 86.3% | 86.4% | 1_135del;378T>C |
| 9 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374335.1 | 85.2% | 84.3% | (many diffs) |
| 10 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374338.1 | 66% | 66.1% | 1_135del;378T>C;693_694ins201 |
| 11 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_006505275.2 | 86.1% | 93% | (many diffs) |
| 12 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_006505276.4 | 85.7% | 92.6% | (many diffs) |
| 13 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_006505274.2 | 84.1% | 90.7% | (many diffs) |
| 14 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | NM_001252374.1 | 82.9% | 89.5% | (many diffs) |
| 15 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | NM_001360963.1 | 82.9% | 89.5% | (many diffs) |
| 16 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_006505273.2 | 82.9% | 89.5% | (many diffs) |
| 17 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_011241111.2 | 82.9% | 89.5% | (many diffs) |
| 18 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_030255051.1 | 82.9% | 89.5% | (many diffs) |
| 19 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | NM_026004.3 | 74.4% | 80.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 924
- ORF length:
- 858
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gccagaattc cagaaaagtt cagttcgaat caagaaccct acaagagtag 121 aagaaattat ctgtggtctt atcaaaggag gagctgccaa acttcagata ataacggact 181 ttgatatgac actcagtaga ttttcatata aagggaaaag atgcccaaca tgtcataata 241 tcattgacaa ctgtaagctg gttacagatg aatgtagaaa aaagttattg caactaaagg 301 aaaaatacta cgctattgaa gttgatcctg ttcttactgt agaagagaag tacccttata 361 tggtggaatg gtatactaaa tcacatggtt tgcttgttca gcaagcttta ccaaaagcta 421 aacttaaaga aattgtggca gaatctgacg ttatgctcaa agaaggatat gagaatttct 481 ttgataagct ccaacaacat agcatccccg tgttcatatt ttcggctgga atcggcgatg 541 tactagagga agttattcgt caagctggtg tttatcatcc caatgtcaaa gttgtgtcca 601 attttatgga ttttgatgaa actggggtgc tcaaaggatt taaaggagaa ctaattcatg 661 tatttaacaa acatgatggt gccttgagga atacagaata tttcaatcaa ctaaaagaCA 721 ATAGTAACAT AATTCTTCTG GGAGACTCCC AAGGAGACTT AAGAATGGCA GATGGAGTGG 781 CCAATGTTGA GCACATTCTG AAAATTGGAT ATCTAAATGA TAGAGTGGAT GAGCTTTTAG 841 AAAAGTACAT GGACTCTTAT GATATTGTTT TAGTACAAGA TGAATCATTA GAAGTAGCCA 901 ACTCTATTTT ACAGAAGATT CTATACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 961 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1021 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT CTACCTATGA 1081 CCGTTGAGTT GCTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1141 att