Construct: ORF TRCN0000472061
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019015.2_s317c1
- Derived from:
- ccsbBroadEn_14722
- DNA Barcode:
- TCCTAGCAGCACTATGGTACACGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NTRK3 (4916)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472061
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001012338.2 | 100% | 100% | |
| 2 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022253.2 | 99.9% | 100% | 678C>T |
| 3 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_002530.4 | 98.2% | 98.3% | 678C>T;2132_2133ins42 |
| 4 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720543.4 | 98.2% | 98.3% | 678C>T;2132_2133ins42 |
| 5 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022240.1 | 98.2% | 98.3% | 678C>T;2132_2133ins42 |
| 6 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022254.2 | 97.7% | 97.2% | (many diffs) |
| 7 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001243101.1 | 97.3% | 97.2% | 1204_1205ins24;2108_2109ins42 |
| 8 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720544.4 | 97.3% | 97.2% | 678C>T;1204_1205ins24;2108_2109ins42 |
| 9 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022241.1 | 90.2% | 88% | (many diffs) |
| 10 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022243.1 | 86.6% | 86.6% | 0_1ins294;384C>T;1838_1839ins42 |
| 11 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022244.2 | 86.6% | 86.6% | 0_1ins294;384C>T;1838_1839ins42 |
| 12 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022245.2 | 86.6% | 86.6% | 0_1ins294;384C>T;1838_1839ins42 |
| 13 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022242.2 | 86.2% | 84.6% | (many diffs) |
| 14 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449933.1 | 85.6% | 85.5% | (many diffs) |
| 15 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720545.4 | 84.9% | 84.7% | (many diffs) |
| 16 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001320135.1 | 73.2% | 73% | (many diffs) |
| 17 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001007156.2 | 69.9% | 64.3% | (many diffs) |
| 18 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_011521637.3 | 69.8% | 64.3% | (many diffs) |
| 19 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449934.1 | 69.8% | 64.3% | (many diffs) |
| 20 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022247.2 | 68.9% | 63.2% | (many diffs) |
| 21 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001320134.1 | 66.1% | 63.6% | (many diffs) |
| 22 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022248.2 | 65.1% | 62.5% | (many diffs) |
| 23 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449935.1 | 64.7% | 63.1% | (many diffs) |
| 24 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720548.4 | 62.8% | 62.9% | 678C>T;1584_1585ins933 |
| 25 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449936.1 | 58.2% | 52.8% | (many diffs) |
| 26 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720549.4 | 58.2% | 54.2% | (many diffs) |
| 27 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720550.4 | 57.2% | 53.1% | (many diffs) |
| 28 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022250.2 | 56% | 55.8% | (many diffs) |
| 29 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_011521638.3 | 55.7% | 55.5% | (many diffs) |
| 30 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_001751293.2 | 52.9% | (many diffs) | |
| 31 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022251.2 | 51.7% | 50.8% | (many diffs) |
| 32 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_002957645.1 | 51.2% | (many diffs) | |
| 33 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022252.2 | 51% | 48.8% | (many diffs) |
| 34 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_001751292.2 | 15.2% | (many diffs) | |
| 35 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250817.2 | 91.2% | 97.2% | (many diffs) |
| 36 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | NM_008746.5 | 89.5% | 95.5% | (many diffs) |
| 37 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_006540691.3 | 88.8% | 94.1% | (many diffs) |
| 38 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250816.2 | 88.5% | 94.4% | (many diffs) |
| 39 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | NM_182809.2 | 63.1% | 61.5% | (many diffs) |
| 40 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_006540692.3 | 60% | 60.9% | (many diffs) |
| 41 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_017322023.1 | 58.9% | 60.6% | (many diffs) |
| 42 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785487.1 | 32.3% | (many diffs) | |
| 43 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785488.1 | 31.1% | (many diffs) | |
| 44 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882023.2 | 27.5% | (many diffs) | |
| 45 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882022.2 | 17.2% | (many diffs) | |
| 46 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785486.1 | 16.9% | (many diffs) | |
| 47 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882025.2 | 15.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2586
- ORF length:
- 2517
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggatgtctct ctttgcccag ccaagtgtag tttctggcgg attttcttgc 121 tgggaagcgt ctggctggac tatgtgggct ccgtgctggc ttgccctgca aattgtgtct 181 gcagcaagac tgagatcaat tgccggcggc cggacgatgg gaacctcttc cccctcctgg 241 aagggcagga ttcagggaac agcaatggga acgccagtat caacatcacg gacatctcaa 301 ggaatatcac ttccatacac atagagaact ggcgcagtct tcacacgctc aacgccgtgg 361 acatggagct ctacaccgga cttcaaaagc tgaccatcaa gaactcagga cttcggagca 421 ttcagcccag agcctttgcc aagaaccccc atttgcgtta tataaacctg tcaagtaacc 481 ggctcaccac actctcgtgg cagctcttcc agacgctgag tcttcgggaa ttgcagttgg 541 agcagaactt tttcaactgc agctgtgaca tccgctggat gcagctctgg caggagcagg 601 gggaggccaa gctcaacagc cagaacctct actgcatcaa cgctgatggc tcccagcttc 661 ctctcttccg catgaacatc agtcagtgtg accttcctga gatcagcgtg agccacgtca 721 acctgaccgt acgagagggt gacaatgctg ttatcacttg caatggctct ggatcacccc 781 ttcctgatgt ggactggata gtcactgggc tgcagtccat caacactcac cagaccaatc 841 tgaactggac caatgttcat gccatcaact tgacgctggt gaatgtgacg agtgaggaca 901 atggcttcac cctgacgtgc attgcagaga acgtggtggg catgagcaat gccagtgttg 961 ccctcactgt ctactatccc ccacgtgtgg tgagcctgga ggagcctgag ctgcgcctgg 1021 agcactgcat cgagtttgtg gtgcgtggca accccccacc aacgctgcac tggctgcaca 1081 atgggcagcc tctgcgggag tccaagatca tccatgtgga atactaccaa gagggagaga 1141 tttccgaggg ctgcctgctc ttcaacaagc ccacccacta caacaatggc aactataccc 1201 tcattgccaa aaacccactg ggcacagcca accagaccat caatggccac ttcctcaagg 1261 agccctttcc agagagcacg gataacttta tcttgtttga cgaagtgagt cccacacctc 1321 ctatcactgt gacccacaaa ccagaagaag acacttttgg ggtatccata gcagttggac 1381 ttgctgcttt tgcctgtgtc ctgttggtgg ttctcttcgt catgatcaac aaatatggtc 1441 gacggtccaa atttggaatg aagggtcccg tggctgtcat cagtggtgag gaggactcag 1501 ccagcccact gcaccacatc aaccacggca tcaccacgcc ctcgtcactg gatgccgggc 1561 ccgacactgt ggtcattggc atgactcgca tccctgtcat tgagaacccc cagtacttcc 1621 gtcagggaca caactgccac aagccggaca cgtatgtgca gcacattaag aggagagaca 1681 tcgtgctgaa gcgagaactg ggtgagggag cctttggaaa ggtcttcctg gccgagtgct 1741 acaacctcag cccgaccaag gacaagatgc ttgtggctgt gaaggccctg aaggatccca 1801 ccctggctgc ccggaaggat ttccagaggg aggccgagct gctcaccaac ctgcagcatg 1861 agcacattgt caagttctat ggagtgtgcg gcgatgggga ccccctcatc atggtctttg 1921 aatacatgaa gcatggagac ctgaataagt tcctcagggc ccatgggcca gatgcaatga 1981 tccttgtgga tggacagcca cgccaggcca agggtgagct ggggctctcc caaatgctcc 2041 acattgccag tcagatcgcc tcgggtatgg tgtacctggc ctcccagcac tttgtgcacc 2101 gagacctggc caccaggaac tgcctggttg gagcgaatct gctagtgaag attggggacT 2161 TCGGCATGTC CAGAGATGTC TACAGCACGG ATTATTACAG GCTCTTTAAT CCATCTGGAA 2221 ATGATTTTTG TATATGGTGT GAGGTGGGAG GACACACCAT GCTCCCCATT CGCTGGATGC 2281 CTCCTGAAAG CATCATGTAC CGGAAGTTCA CTACAGAGAG TGATGTATGG AGCTTCGGGG 2341 TGATCCTCTG GGAGATCTTC ACCTATGGAA AGCAGCCATG GTTCCAACTC TCAAACACGG 2401 AGGTCATTGA GTGCATTACC CAAGGTCGTG TTTTGGAGCG GCCCCGAGTC TGCCCCAAAG 2461 AGGTGTACGA TGTCATGCTG GGGTGCTGGC AGAGGGAACC ACAGCAGCGG TTGAACATCA 2521 AGGAGATCTA CAAAATCCTC CATGCTTTGG GGAAGGCCAC CCCAATCTAC CTGGACATTC 2581 TTGGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 2641 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 2701 GGCTTTATAT ATCTTGTGGA AAGGACGATC CTAGCAGCAC TATGGTACAC GGACGCGTTA 2761 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt