Transcript: Human XM_017022252.2

PREDICTED: Homo sapiens neurotrophic receptor tyrosine kinase 3 (NTRK3), transcript variant X26, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NTRK3 (4916)
Length:
18633
CDS:
101..1447

Additional Resources:

NCBI RefSeq record:
XM_017022252.2
NBCI Gene record:
NTRK3 (4916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022252.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219677 ATGTCTACAGCACGGATTATT pLKO.1 1077 CDS 100% 15.000 21.000 N NTRK3 n/a
2 TRCN0000379993 ATATGGTCGACGGTCCAAATT pLKO_005 334 CDS 100% 13.200 18.480 N NTRK3 n/a
3 TRCN0000002311 GCACATTAAGAGGAGAGACAT pLKO.1 562 CDS 100% 4.950 3.960 N NTRK3 n/a
4 TRCN0000382153 ACGTATGTGCAGCACATTAAG pLKO_005 551 CDS 100% 13.200 9.240 N NTRK3 n/a
5 TRCN0000415150 TGAAGCATGGAGACCTGAATA pLKO_005 828 CDS 100% 13.200 9.240 N NTRK3 n/a
6 TRCN0000194821 CCAATCTACCTGGACATTCTT pLKO.1 1421 CDS 100% 5.625 3.938 N NTRK3 n/a
7 TRCN0000338262 CCAATCTACCTGGACATTCTT pLKO_005 1421 CDS 100% 5.625 3.938 N NTRK3 n/a
8 TRCN0000219678 TGGTGGCTGGTGGTCATGAAT pLKO.1 1448 CDS 100% 5.625 3.938 N NTRK3 n/a
9 TRCN0000002310 CAAAGAGGTGTACGATGTCAT pLKO.1 1315 CDS 100% 4.950 3.465 N NTRK3 n/a
10 TRCN0000002312 TCATACTCTGTTGCCTCCTCT pLKO.1 1469 3UTR 100% 2.640 1.848 N NTRK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022252.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492346 TATCGCCAAACGCTGCGCAATAAT pLX_317 23.2% 81.9% .6% V5 (not translated due to prior stop codon) 1_235del;1344_1345insTAGAAGCTT n/a
2 TRCN0000489478 CACGGAAAAAGCCGCCAGTGATGG pLX_317 16.1% 51.9% 49.7% V5 (many diffs) n/a
3 TRCN0000488840 TCGATGGTACGGTTACAATCTGAG pLX_317 13.2% 51.9% 49.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000491535 CCGAAACTCTCCGAGAGGCGTCAT pLX_317 12.8% 51.8% 49.6% V5 (many diffs) n/a
5 ccsbBroadEn_14722 pDONR223 0% 51% 48.8% None (many diffs) n/a
6 ccsbBroad304_14722 pLX_304 0% 51% 48.8% V5 (many diffs) n/a
7 TRCN0000472061 TCCTAGCAGCACTATGGTACACGG pLX_317 17.1% 51% 48.8% V5 (many diffs) n/a
Download CSV