Transcript: Human XM_017022245.2

PREDICTED: Homo sapiens neurotrophic receptor tyrosine kinase 3 (NTRK3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NTRK3 (4916)
Length:
20228
CDS:
859..3042

Additional Resources:

NCBI RefSeq record:
XM_017022245.2
NBCI Gene record:
NTRK3 (4916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147858 CATGTGGAATACTACCAAGA pXPR_003 GGG 767 35% 9 0.7702 NTRK3 NTRK3 76181
2 BRDN0001145045 TCATGCCATCAACTTGACGC pXPR_003 TGG 511 23% 8 0.0912 NTRK3 NTRK3 76179
3 BRDN0001145325 CGTCAACCTGACCGTACGAG pXPR_003 AGG 370 17% 7 -0.4591 NTRK3 NTRK3 76180
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022245.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219677 ATGTCTACAGCACGGATTATT pLKO.1 2672 CDS 100% 15.000 21.000 N NTRK3 n/a
2 TRCN0000379993 ATATGGTCGACGGTCCAAATT pLKO_005 1929 CDS 100% 13.200 18.480 N NTRK3 n/a
3 TRCN0000381538 ACGCTGAGTCTTCGGGAATTG pLKO_005 1009 CDS 100% 10.800 8.640 N NTRK3 n/a
4 TRCN0000002311 GCACATTAAGAGGAGAGACAT pLKO.1 2157 CDS 100% 4.950 3.960 N NTRK3 n/a
5 TRCN0000382153 ACGTATGTGCAGCACATTAAG pLKO_005 2146 CDS 100% 13.200 9.240 N NTRK3 n/a
6 TRCN0000415150 TGAAGCATGGAGACCTGAATA pLKO_005 2423 CDS 100% 13.200 9.240 N NTRK3 n/a
7 TRCN0000195281 CGGATAACTTTATCTTGTTTG pLKO.1 1775 CDS 100% 10.800 7.560 N NTRK3 n/a
8 TRCN0000002309 CACTACAACAATGGCAACTAT pLKO.1 1672 CDS 100% 5.625 3.938 N NTRK3 n/a
9 TRCN0000194821 CCAATCTACCTGGACATTCTT pLKO.1 3016 CDS 100% 5.625 3.938 N NTRK3 n/a
10 TRCN0000338262 CCAATCTACCTGGACATTCTT pLKO_005 3016 CDS 100% 5.625 3.938 N NTRK3 n/a
11 TRCN0000219678 TGGTGGCTGGTGGTCATGAAT pLKO.1 3043 CDS 100% 5.625 3.938 N NTRK3 n/a
12 TRCN0000002310 CAAAGAGGTGTACGATGTCAT pLKO.1 2910 CDS 100% 4.950 3.465 N NTRK3 n/a
13 TRCN0000195282 CCAATGTTCATGCCATCAACT pLKO.1 1346 CDS 100% 4.950 3.465 N NTRK3 n/a
14 TRCN0000002312 TCATACTCTGTTGCCTCCTCT pLKO.1 3064 3UTR 100% 2.640 1.848 N NTRK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022245.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489478 CACGGAAAAAGCCGCCAGTGATGG pLX_317 16.1% 88% 88.1% V5 0_1ins294;384C>T n/a
2 TRCN0000488840 TCGATGGTACGGTTACAATCTGAG pLX_317 13.2% 88% 88.1% V5 (not translated due to prior stop codon) 0_1ins294;384C>T n/a
3 TRCN0000491535 CCGAAACTCTCCGAGAGGCGTCAT pLX_317 12.8% 88% 88% V5 0_1ins294;384C>T;2181_2182insG n/a
4 ccsbBroadEn_14722 pDONR223 0% 86.6% 86.6% None 0_1ins294;384C>T;1838_1839ins42 n/a
5 ccsbBroad304_14722 pLX_304 0% 86.6% 86.6% V5 0_1ins294;384C>T;1838_1839ins42 n/a
6 TRCN0000472061 TCCTAGCAGCACTATGGTACACGG pLX_317 17.1% 86.6% 86.6% V5 0_1ins294;384C>T;1838_1839ins42 n/a
7 ccsbBroadEn_06660 pDONR223 100% 59.2% 53.7% None (many diffs) n/a
8 ccsbBroad304_06660 pLX_304 0% 59.2% 53.7% V5 (many diffs) n/a
9 TRCN0000466614 AAAGTCTCTCTGTCTGGGCCCTCG pLX_317 19.7% 59.2% 53.7% V5 (many diffs) n/a
10 TRCN0000492346 TATCGCCAAACGCTGCGCAATAAT pLX_317 23.2% 50.6% .4% V5 (not translated due to prior stop codon) 1_1072del;2181_2182insTAGAAGCTT n/a
Download CSV