Transcript: Human XM_011512754.1

PREDICTED: Homo sapiens transmembrane serine protease 7 (TMPRSS7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMPRSS7 (344805)
Length:
2954
CDS:
487..2769

Additional Resources:

NCBI RefSeq record:
XM_011512754.1
NBCI Gene record:
TMPRSS7 (344805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245945 CTCAGGAATCCGGGCATATTT pLKO_005 1287 CDS 100% 15.000 21.000 N TMPRSS7 n/a
2 TRCN0000245944 TTAGATGCTCCTCCGGTTTAT pLKO_005 1703 CDS 100% 13.200 18.480 N TMPRSS7 n/a
3 TRCN0000245943 ATGCTCTGTGCAGGCATAATG pLKO_005 2554 CDS 100% 13.200 9.240 N TMPRSS7 n/a
4 TRCN0000245942 TTGTGGTCCACGAGTACTATA pLKO_005 2276 CDS 100% 13.200 9.240 N TMPRSS7 n/a
5 TRCN0000245941 AGCGTTGTGATGGAGTAAATG pLKO_005 1739 CDS 100% 13.200 7.920 N TMPRSS7 n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2931 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2853 3UTR 100% 4.950 2.475 Y ERN2 n/a
8 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2853 3UTR 100% 4.950 2.475 Y P3H4 n/a
9 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2853 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13607 pDONR223 100% 75.2% 75.1% None 1_564del;2197A>T n/a
2 ccsbBroad304_13607 pLX_304 0% 75.2% 75.1% V5 1_564del;2197A>T n/a
3 TRCN0000472068 TTGTTTAGTCGAATGTCGGCAGCA pLX_317 24.4% 75.2% 75.1% V5 1_564del;2197A>T n/a
Download CSV