Construct: ORF TRCN0000472161
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013251.1_s317c1
- Derived from:
- ccsbBroadEn_08182
- DNA Barcode:
- GTACTACAGACCACTATCGTCGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- COPS7A (50813)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472161
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 50813 | COPS7A | COP9 signalosome subunit 7A | NM_001164093.2 | 99.8% | 99.6% | 12A>C |
| 2 | human | 50813 | COPS7A | COP9 signalosome subunit 7A | NM_001164094.2 | 99.8% | 99.6% | 12A>C |
| 3 | human | 50813 | COPS7A | COP9 signalosome subunit 7A | NM_001164095.3 | 99.8% | 99.6% | 12A>C |
| 4 | human | 50813 | COPS7A | COP9 signalosome subunit 7A | NM_016319.4 | 99.8% | 99.6% | 12A>C |
| 5 | human | 50813 | COPS7A | COP9 signalosome subunit 7A | XM_005253694.2 | 99.8% | 99.6% | 12A>C |
| 6 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | NM_012003.2 | 91.2% | 98.5% | (many diffs) |
| 7 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | XM_006506162.3 | 91.2% | 98.5% | (many diffs) |
| 8 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | XM_011241365.2 | 91.2% | 98.5% | (many diffs) |
| 9 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | XM_017321593.1 | 91.2% | 98.5% | (many diffs) |
| 10 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | NM_001164089.1 | 87.3% | 92.5% | (many diffs) |
| 11 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | XM_006506159.3 | 87.3% | 92.5% | (many diffs) |
| 12 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | XM_006506160.2 | 87.3% | 92.5% | (many diffs) |
| 13 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | XM_006506161.2 | 87.3% | 92.5% | (many diffs) |
| 14 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | XM_006506157.1 | 82.6% | 87.6% | (many diffs) |
| 15 | mouse | 26894 | Cops7a | COP9 signalosome subunit 7A | XM_011241366.1 | 81.7% | 86.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 891
- ORF length:
- 825
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tgcggacgtg aaggtgacag ggcagaacca ggagcaattt ctgctcctag 121 ccaagtcggc caagggggca gcgctggcca cactcatcca tcaggtgctg gaggcccctg 181 gtgtctacgt gtttggagaa ctgctggaca tgcccaatgt tagagagctg gctgagagtg 241 actttgcctc taccttccgg ctgctcacag tgtttgctta tgggacatac gctgactact 301 tagctgaagc ccggaatctt cctccactaa cagaggctca gaagaataag cttcgacacc 361 tctcagttgt caccctggct gctaaagtaa agtgtatccc atatgcagtg ttgctggagg 421 ctcttgcccT GCGTAATGTG CGGCAGCTGG AAGACCTTGT GATTGAGGCT GTGTATGCTG 481 ACGTGCTTCG TGGCTCCCTG GACCAGCGCA ACCAGCGGCT CGAGGTTGAC TACAGCATCG 541 GGCGGGACAT CCAGCGCCAG GACCTCAGTG CCATTGCCCG AACCCTGCAG GAATGGTGTG 601 TGGGCTGTGA GGTCGTGCTG TCAGGCATTG AGGAGCAGGT GAGCCGTGCC AACCAACACA 661 AGGAGCAGCA GCTGGGCCTG AAGCAGCAGA TTGAGAGTGA GGTTGCCAAC CTTAAAAAAA 721 CCATTAAAGT TACGACGGCA GCAGCAGCCG CAGCCACATC TCAGGACCCT GAGCAACACC 781 TGACTGAGCT GAGGGAACCA GCTCCTGGCA CCAACCAGCG CCAGCCCAGC AAGAAAGCCT 841 CAAAGGGCAA GGGGCTCCGA GGGAGCGCCA AGATTTGGTC CAAGTCGAAT TGCCCAACTT 901 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 961 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1021 CTTGTGGAAA GGACGAGTAC TACAGACCAC TATCGTCGGG ACGCGTTAAG TCgacaatca 1081 acctctggat tacaaaattt gtgaaagatt