Transcript: Human NM_016319.4

Homo sapiens COP9 signalosome subunit 7A (COPS7A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
COPS7A (50813)
Length:
1804
CDS:
151..978

Additional Resources:

NCBI RefSeq record:
NM_016319.4
NBCI Gene record:
COPS7A (50813)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016319.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117805 AGAGTGAGGTTGCCAACCTTA pLKO.1 779 CDS 100% 4.950 3.465 N COPS7A n/a
2 TRCN0000333462 AGAGTGAGGTTGCCAACCTTA pLKO_005 779 CDS 100% 4.950 3.465 N COPS7A n/a
3 TRCN0000117803 CCCGGAATCTTCCTCCACTAA pLKO.1 395 CDS 100% 4.950 3.465 N COPS7A n/a
4 TRCN0000333460 CCCGGAATCTTCCTCCACTAA pLKO_005 395 CDS 100% 4.950 3.465 N COPS7A n/a
5 TRCN0000117802 CCCTGTTCATTACATGTCATT pLKO.1 1257 3UTR 100% 4.950 3.465 N COPS7A n/a
6 TRCN0000333463 CCCTGTTCATTACATGTCATT pLKO_005 1257 3UTR 100% 4.950 3.465 N COPS7A n/a
7 TRCN0000117806 CAAGATTTGGTCCAAGTCGAA pLKO.1 954 CDS 100% 2.640 1.848 N COPS7A n/a
8 TRCN0000117804 CAGCAGATTGAGAGTGAGGTT pLKO.1 769 CDS 100% 2.640 1.584 N COPS7A n/a
9 TRCN0000333461 CAGCAGATTGAGAGTGAGGTT pLKO_005 769 CDS 100% 2.640 1.584 N COPS7A n/a
10 TRCN0000120886 CAGAAGAATAAGCTTCGACAT pLKO.1 424 CDS 100% 4.050 2.835 N Cops7a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016319.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08182 pDONR223 100% 99.8% 99.6% None 12A>C n/a
2 ccsbBroad304_08182 pLX_304 0% 99.8% 99.6% V5 12A>C n/a
3 TRCN0000472161 GTACTACAGACCACTATCGTCGGG pLX_317 55.8% 99.8% 99.6% V5 12A>C n/a
Download CSV