Transcript: Mouse XM_011241365.2

PREDICTED: Mus musculus COP9 signalosome subunit 7A (Cops7a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cops7a (26894)
Length:
2174
CDS:
198..1025

Additional Resources:

NCBI RefSeq record:
XM_011241365.2
NBCI Gene record:
Cops7a (26894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241365.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375674 GGACCTATGCGGACTACTTAG pLKO_005 415 CDS 100% 10.800 15.120 N Cops7a n/a
2 TRCN0000120884 CCAAAGTCAAGTGTATCCCAT pLKO.1 514 CDS 100% 2.640 3.696 N Cops7a n/a
3 TRCN0000351112 CCAAAGTCAAGTGTATCCCAT pLKO_005 514 CDS 100% 2.640 3.696 N Cops7a n/a
4 TRCN0000351052 TCAGCGGCTAGAGGTTGATTA pLKO_005 644 CDS 100% 13.200 9.240 N Cops7a n/a
5 TRCN0000379283 GAACTGCTGGATATGCCTAAT pLKO_005 330 CDS 100% 10.800 7.560 N Cops7a n/a
6 TRCN0000120883 CAAAGTCAAGTGTATCCCATA pLKO.1 515 CDS 100% 4.050 2.835 N Cops7a n/a
7 TRCN0000120886 CAGAAGAATAAGCTTCGACAT pLKO.1 471 CDS 100% 4.050 2.835 N Cops7a n/a
8 TRCN0000120882 GCAGGTCATGTTCTGTTGGTA pLKO.1 1197 3UTR 100% 3.000 2.100 N Cops7a n/a
9 TRCN0000340166 GCAGGTCATGTTCTGTTGGTA pLKO_005 1197 3UTR 100% 3.000 2.100 N Cops7a n/a
10 TRCN0000117806 CAAGATTTGGTCCAAGTCGAA pLKO.1 1001 CDS 100% 2.640 1.848 N COPS7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241365.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08182 pDONR223 100% 91.2% 98.5% None (many diffs) n/a
2 ccsbBroad304_08182 pLX_304 0% 91.2% 98.5% V5 (many diffs) n/a
3 TRCN0000472161 GTACTACAGACCACTATCGTCGGG pLX_317 55.8% 91.2% 98.5% V5 (many diffs) n/a
Download CSV