Construct: ORF TRCN0000472279
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011555.1_s317c1
- Derived from:
- ccsbBroadEn_00090
- DNA Barcode:
- AAGACTGCGTATAAGGATGTCGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AQP4 (361)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472279
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 361 | AQP4 | aquaporin 4 | NM_001650.7 | 100% | 100% | |
2 | human | 361 | AQP4 | aquaporin 4 | XM_011525942.3 | 97.3% | 96.5% | 4_6delTTCinsAGT;9A>C;11_11delTins22 |
3 | human | 361 | AQP4 | aquaporin 4 | NM_001364286.1 | 93.1% | 93.1% | 0_1ins66 |
4 | human | 361 | AQP4 | aquaporin 4 | NM_004028.4 | 93.1% | 93.1% | 0_1ins66 |
5 | human | 361 | AQP4 | aquaporin 4 | NM_001317384.2 | 91.7% | 100% | 970_1056del |
6 | human | 361 | AQP4 | aquaporin 4 | NM_001317387.2 | 91.6% | 91.6% | 612_613ins81 |
7 | human | 361 | AQP4 | aquaporin 4 | NM_001364287.1 | 85.5% | 93.1% | 0_1ins66;904_990del |
8 | human | 361 | AQP4 | aquaporin 4 | NM_001364289.1 | 85.5% | 93.1% | 0_1ins66;904_990del |
9 | mouse | 11829 | Aqp4 | aquaporin 4 | NM_009700.3 | 88.1% | 93.1% | (many diffs) |
10 | mouse | 11829 | Aqp4 | aquaporin 4 | NM_001308641.1 | 82.4% | 88.2% | (many diffs) |
11 | mouse | 11829 | Aqp4 | aquaporin 4 | NM_001308642.1 | 82.4% | 88.2% | (many diffs) |
12 | mouse | 11829 | Aqp4 | aquaporin 4 | NM_001308643.1 | 82.4% | 88.2% | (many diffs) |
13 | mouse | 11829 | Aqp4 | aquaporin 4 | NM_001308644.1 | 82.4% | 88.2% | (many diffs) |
14 | mouse | 11829 | Aqp4 | aquaporin 4 | NM_001308645.1 | 82.4% | 88.2% | (many diffs) |
15 | mouse | 11829 | Aqp4 | aquaporin 4 | NM_001308646.1 | 82.4% | 88.2% | (many diffs) |
16 | mouse | 11829 | Aqp4 | aquaporin 4 | NM_001308647.2 | 82.4% | 88.2% | (many diffs) |
17 | mouse | 11829 | Aqp4 | aquaporin 4 | NM_001317729.1 | 80.8% | 93.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1035
- ORF length:
- 969
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tgacagaccc acagcaaggc ggtggggtaa gtgtggacct ttgtgtacca 121 gagagaacat catggtggct ttcaaagggg tctggactca agctttctgg aaagcagtca 181 cagcggaatt tctggccatg cttatttttg ttctcctcag cctgggatcc accatcaact 241 ggggtggaac agaaaagcct ttaccggtcg acatggttct catctccctt tgctttggac 301 tcagcattgc aaccatggtg cagtgctttg gccatatcag cggtggccac atcaaccctg 361 cagtgactgt ggccatggtg tgcaccagga agatcagcat cgccaagtct gtcttctaca 421 tcgcagccca gtgcctgggg gccatcattg gagcaggaat cctctatctg gtcacacctc 481 ccagtgtggt gggaggcctg ggagtcacca tggttcatgg aaatcttacc gctggtcatg 541 gtctcctggt tgagttgata atcacatttc aattggtgtt tactatcttt gccagctgtg 601 attccaaacg gactgatgtc actggctcaa tagctttagc aattggattt tctgttgcaa 661 ttggacattt atttgcaatc aattatactg gtgccagcat gaatcccgcc cgatcctttg 721 gacctgcagt tatcatggga aattgggaaa accattGGAT ATATTGGGTT GGGCCCATCA 781 TAGGAGCTGT CCTCGCTGGT GGCCTTTATG AGTATGTCTT CTGTCCAGAT GTTGAATTCA 841 AACGTCGTTT TAAAGAAGCC TTCAGCAAAG CTGCCCAGCA AACAAAAGGA AGCTACATGG 901 AGGTGGAGGA CAACAGGAGT CAGGTAGAGA CGGATGACCT GATTCTAAAA CCTGGAGTGG 961 TGCATGTGAT TGACGTTGAC CGGGGAGAGG AGAAGAAGGG GAAAGACCAA TCTGGAGAGG 1021 TATTGTCTTC AGTATGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1081 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1141 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AAGACTGCGT ATAAGGATGT 1201 CGTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt