Transcript: Human XM_011525942.3

PREDICTED: Homo sapiens aquaporin 4 (AQP4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AQP4 (361)
Length:
5337
CDS:
219..1169

Additional Resources:

NCBI RefSeq record:
XM_011525942.3
NBCI Gene record:
AQP4 (361)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059608 GCATTCAATAAGTTACGGTTA pLKO.1 3244 3UTR 100% 4.050 5.670 N AQP4 n/a
2 TRCN0000059609 CCTGCAGTTATCATGGGAAAT pLKO.1 855 CDS 100% 10.800 8.640 N AQP4 n/a
3 TRCN0000059611 GAGACGGATGACCTGATTCTA pLKO.1 1059 CDS 100% 5.625 3.938 N AQP4 n/a
4 TRCN0000059612 CATCGCCAAGTCTGTCTTCTA pLKO.1 530 CDS 100% 4.950 3.465 N AQP4 n/a
5 TRCN0000059610 CGGAATTTCTGGCCATGCTTA pLKO.1 316 CDS 100% 4.950 3.465 N AQP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00090 pDONR223 100% 97.3% 96.5% None 4_6delTTCinsAGT;9A>C;11_11delTins22 n/a
2 ccsbBroad304_00090 pLX_304 0% 97.3% 96.5% V5 4_6delTTCinsAGT;9A>C;11_11delTins22 n/a
3 TRCN0000472279 AAGACTGCGTATAAGGATGTCGTC pLX_317 29.2% 97.3% 96.5% V5 4_6delTTCinsAGT;9A>C;11_11delTins22 n/a
Download CSV