Transcript: Mouse NM_001308647.2

Mus musculus aquaporin 4 (Aqp4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Aqp4 (11829)
Length:
5338
CDS:
376..1281

Additional Resources:

NCBI RefSeq record:
NM_001308647.2
NBCI Gene record:
Aqp4 (11829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001308647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119600 ACCCGCAGTTATCATGGGAAA pLKO.1 966 CDS 100% 4.050 5.670 N Aqp4 n/a
2 TRCN0000119599 GAGAGGTATTGTCTTCCGTAT pLKO.1 1259 CDS 100% 4.050 5.670 N Aqp4 n/a
3 TRCN0000119598 GAACTGATGTTACTGGTTCAA pLKO.1 854 CDS 100% 4.950 3.465 N Aqp4 n/a
4 TRCN0000119601 CAATTGGACATTTGTTTGCAA pLKO.1 902 CDS 100% 3.000 2.100 N Aqp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00090 pDONR223 100% 82.4% 88.2% None (many diffs) n/a
2 ccsbBroad304_00090 pLX_304 0% 82.4% 88.2% V5 (many diffs) n/a
3 TRCN0000472279 AAGACTGCGTATAAGGATGTCGTC pLX_317 29.2% 82.4% 88.2% V5 (many diffs) n/a
Download CSV