Construct: ORF TRCN0000472307
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007770.1_s317c1
- Derived from:
- ccsbBroadEn_02750
- DNA Barcode:
- TGCCAGTACACTCAATGATAGGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ICOSLG (23308)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472307
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 102723996 | LOC102723996 | ICOS ligand | NM_001363770.2 | 100% | 100% | |
2 | human | 23308 | ICOSLG | inducible T cell costimulat... | NM_015259.6 | 100% | 100% | |
3 | human | 23308 | ICOSLG | inducible T cell costimulat... | XM_011529515.3 | 98.6% | 98.6% | 899_906delTTCCAGGA;909A>C;912_912delAinsGTT |
4 | human | 102723996 | LOC102723996 | ICOS ligand | XM_011546079.1 | 98.6% | 98.6% | 899_906delTTCCAGGA;909A>C;912_912delAinsGTT |
5 | human | 23308 | ICOSLG | inducible T cell costimulat... | NM_001283050.2 | 97.3% | 96.7% | (many diffs) |
6 | human | 23308 | ICOSLG | inducible T cell costimulat... | NM_001365759.2 | 91% | 91% | 0_1ins81 |
7 | human | 23308 | ICOSLG | inducible T cell costimulat... | XM_011529514.3 | 83.4% | 82.6% | (many diffs) |
8 | human | 102723996 | LOC102723996 | ICOS ligand | XM_011546078.2 | 83.4% | 82.6% | (many diffs) |
9 | human | 23308 | ICOSLG | inducible T cell costimulat... | XM_011529516.3 | 75.9% | 75.2% | (many diffs) |
10 | human | 23308 | ICOSLG | inducible T cell costimulat... | NM_001283052.2 | 71.8% | 71.8% | 0_1ins255 |
11 | human | 23308 | ICOSLG | inducible T cell costimulat... | XM_024452060.1 | 63.5% | 63.4% | 900_901delTGinsCC;902_903insC;906_1419del |
12 | human | 23308 | ICOSLG | inducible T cell costimulat... | NM_001283051.2 | 61.2% | 61.2% | 54_55ins351 |
13 | human | 102723996 | LOC102723996 | ICOS ligand | XM_006723899.2 | 58.2% | 58.1% | 900_901delTGinsCC;902_903insC;906_1548del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 972
- ORF length:
- 906
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg gctgggcagt cctggactgc tcttcctgct cttcagcagc cttcgagctg 121 atactcagga gaaggaagtc agagcgatgg taggcagcga cgtggagctc agctgcgctt 181 gccctgaagg aagccgtttt gatttaaatg atgtttacgt atattggcaa accagtgagt 241 cgaaaaccgt ggtgacctac cacatcccac agaacagctc cttggaaaac gtggacagcc 301 gctaccggaa ccgagccctg atgtcaccgg ccggcatgct gcggggcgac ttctccctgc 361 gcttgttcaa cgtcaccccc caggacgagc agaagtttca ctgcctggtg ttgagccaat 421 ccctgggatt ccaggaggtt ttgagcgttg aggttacact gcatgtGGCA GCAAACTTCA 481 GCGTGCCCGT CGTCAGCGCC CCCCACAGCC CCTCCCAGGA TGAGCTCACC TTCACGTGTA 541 CATCCATAAA CGGCTACCCC AGGCCCAACG TGTACTGGAT CAATAAGACG GACAACAGCC 601 TGCTGGACCA GGCTCTGCAG AATGACACCG TCTTCTTGAA CATGCGGGGC TTGTATGACG 661 TGGTCAGCGT GCTGAGGATC GCACGGACCC CCAGCGTGAA CATTGGCTGC TGCATAGAGA 721 ACGTGCTTCT GCAGCAGAAC CTGACTGTCG GCAGCCAGAC AGGAAATGAC ATCGGAGAGA 781 GAGACAAGAT CACAGAGAAT CCAGTCAGTA CCGGCGAGAA AAACGCGGCC ACGTGGAGCA 841 TCCTGGCTGT CCTGTGCCTG CTTGTGGTCG TGGCGGTGGC CATAGGCTGG GTGTGCAGGG 901 ACCGATGCCT CCAACACAGC TATGCAGGTG CCTGGGCTGT GAGTCCGGAG ACAGAGCTCA 961 CTGGCCACGT TTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1021 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1081 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATGC CAGTACACTC AATGATAGGA 1141 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t