Transcript: Human NM_001283051.2

Homo sapiens inducible T cell costimulator ligand (ICOSLG), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ICOSLG (23308)
Length:
6727
CDS:
127..684

Additional Resources:

NCBI RefSeq record:
NM_001283051.2
NBCI Gene record:
ICOSLG (23308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001283051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5417 3UTR 100% 13.200 6.600 Y LIAS n/a
2 TRCN0000056969 CCCAACGTGTACTGGATCAAT pLKO.1 274 CDS 100% 5.625 2.813 Y ICOSLG n/a
3 TRCN0000056972 CATCGGAGAGAGAGACAAGAT pLKO.1 480 CDS 100% 4.950 2.475 Y ICOSLG n/a
4 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5181 3UTR 100% 4.950 2.475 Y n/a
5 TRCN0000056971 GCAGAATGACACCGTCTTCTT pLKO.1 327 CDS 100% 4.950 2.475 Y ICOSLG n/a
6 TRCN0000056968 CCTCCTTCTTACTTCCCAGAA pLKO.1 1971 3UTR 100% 4.050 2.025 Y ICOSLG n/a
7 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5714 3UTR 100% 10.800 5.400 Y SMIM11A n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5254 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5254 3UTR 100% 5.625 2.813 Y EID2B n/a
10 TRCN0000161892 GCCTGTAATTCCAGCTACTTA pLKO.1 5684 3UTR 100% 5.625 2.813 Y GPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02750 pDONR223 100% 61.2% 61.2% None 54_55ins351 n/a
2 ccsbBroad304_02750 pLX_304 0% 61.2% 61.2% V5 54_55ins351 n/a
3 TRCN0000472307 TGCCAGTACACTCAATGATAGGAA pLX_317 55.7% 61.2% 61.2% V5 54_55ins351 n/a
Download CSV