Transcript: Human XM_011529514.3

PREDICTED: Homo sapiens inducible T cell costimulator ligand (ICOSLG), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ICOSLG (23308)
Length:
2287
CDS:
125..1210

Additional Resources:

NCBI RefSeq record:
XM_011529514.3
NBCI Gene record:
ICOSLG (23308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529514.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056969 CCCAACGTGTACTGGATCAAT pLKO.1 623 CDS 100% 5.625 2.813 Y ICOSLG n/a
2 TRCN0000056972 CATCGGAGAGAGAGACAAGAT pLKO.1 829 CDS 100% 4.950 2.475 Y ICOSLG n/a
3 TRCN0000056971 GCAGAATGACACCGTCTTCTT pLKO.1 676 CDS 100% 4.950 2.475 Y ICOSLG n/a
4 TRCN0000056970 GCTGATACTCAGGAGAAGGAA pLKO.1 176 CDS 100% 3.000 1.500 Y ICOSLG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529514.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02750 pDONR223 100% 83.4% 82.6% None (many diffs) n/a
2 ccsbBroad304_02750 pLX_304 0% 83.4% 82.6% V5 (many diffs) n/a
3 TRCN0000472307 TGCCAGTACACTCAATGATAGGAA pLX_317 55.7% 83.4% 82.6% V5 (many diffs) n/a
Download CSV