Construct: ORF TRCN0000472354
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004647.1_s317c1
- Derived from:
- ccsbBroadEn_08693
- DNA Barcode:
- CTGAGTTACTATTCACGCCTCTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DAZ2 (57055)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472354
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57055 | DAZ2 | deleted in azoospermia 2 | NM_001005785.2 | 99.9% | 99.8% | 1073A>N |
| 2 | human | 57055 | DAZ2 | deleted in azoospermia 2 | NM_020363.3 | 95.6% | 95.5% | 913_984del;1145A>N |
| 3 | human | 57135 | DAZ4 | deleted in azoospermia 4 | XM_011531510.1 | 86.4% | 86.3% | (many diffs) |
| 4 | human | 57054 | DAZ3 | deleted in azoospermia 3 | NM_020364.3 | 81% | 80.3% | (many diffs) |
| 5 | human | 57135 | DAZ4 | deleted in azoospermia 4 | XM_011531509.3 | 79% | 78.9% | (many diffs) |
| 6 | human | 57135 | DAZ4 | deleted in azoospermia 4 | NM_001005375.2 | 79% | 59% | (many diffs) |
| 7 | human | 57135 | DAZ4 | deleted in azoospermia 4 | XM_005262602.1 | 73.5% | 73.4% | (many diffs) |
| 8 | human | 57135 | DAZ4 | deleted in azoospermia 4 | NM_020420.3 | 72.9% | 73% | 504C>T;993_994ins432 |
| 9 | human | 57055 | DAZ2 | deleted in azoospermia 2 | NM_001005786.2 | 68.4% | 68.3% | 663T>A;682_683ins504 |
| 10 | human | 1617 | DAZ1 | deleted in azoospermia 1 | XM_011531482.2 | 66.2% | 50.7% | (many diffs) |
| 11 | human | 1617 | DAZ1 | deleted in azoospermia 1 | XM_011531483.1 | 63.6% | 63.6% | (many diffs) |
| 12 | human | 1617 | DAZ1 | deleted in azoospermia 1 | NM_004081.5 | 61.9% | 47.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1671
- ORF length:
- 1602
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtctgctgca aatcctgaga ctccaaactc aaccatctcc agagaggcca 121 gcacccagtc ttcatcagct gcagctagcc aaggctgggt gttaccagaa ggcaaaatcg 181 tgccaaacac tgtttttgtt ggtggaattg atgctaggat ggatgaaact gagattggaa 241 gctgctttgg tagatacggt tcagtgaaag aagtgaagat aatcacgaat cgaactggtg 301 tgtccaaagg ctatggattt gtttcgtttg ttaatgacgt ggatgtccag aagatagtag 361 gatcacagat acatttccat ggtaaaaagc tgaagctggg ccctgcaatc aggaaacaaa 421 agttatgtgc tcgtcatgtg cagccacgtc ctttggtagt taatcctcct cctccaccac 481 agtttcagaa cgtctggcgg aatccaaaca ctgaaaccta cctgcagccc caaatcacgc 541 cgaatcctgt aactcagcac gttcaggctt attctgctta tccacattca ccaggtcagg 601 tcatcactgg atgtcagttg cttgtatata attatcagga atatcctact tatcccgatt 661 cagcatttca ggtcaccact ggatatcagt tgcctgtata taattatcag ccatttcctg 721 cttatccaag atcaccattt caggtcactg ctggatatca gttgcctgta tataattatc 781 aggcatttcc tgcttatcca aattcaccat ttcaagtcgc cactggatat cagttccctg 841 tatacaatta tcagccattt cctgcttatc caagttcacc atttcaggtc actgctggat 901 atcagttgcc tgtatataat tatcaggcat ttcctgctta tccaaattca ccatttcaag 961 tcgccactgg atatcagttc cctgtataca attatcaggc atttcctgct tatccaaatt 1021 caccagttca ggtcaccact ggatatcagt tgcctgtata caattatcag gcatttcctg 1081 cttatccaag ttcaccattt caggtcacca ctggatatca gttgcctgta tataattatc 1141 nggcatttcc tgcttatcca agttcaccat ttcaggtcac cactggatat cagttgcctg 1201 tatataatta tcaggcattt cctgcttatc caagttcacc atttcaggtc accactggat 1261 atcagttgcc tgtatataat tatcaggcat ttcctgctta tccaagttca ccatttcagg 1321 tcaccactgg atatcagttg cctgtatata attatcaggc atttcctgct tatccaagtt 1381 caccatttca ggtcaccact ggatatcagt tgcctgtata taattatcag gcatttcctg 1441 cttatccaag ttcaccattt caggtcacca ctggatatca gttgcctgta tataattatc 1501 aggcatttcc tgcttatcca aattcagcag ttcaggtcac cactggatat cagttccatg 1561 tatacaatta ccagatgcca ccgcagtgcc ctgttgggga gcaaaggaga aatcTGTGGA 1621 CCGAAGCATA CAAATGGTGG TATCTTGTCT GTTTAATCCA GAGAAGAGAC TTGCCAACTT 1681 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1741 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1801 CTTGTGGAAA GGACGACTGA GTTACTATTC ACGCCTCTGT ACGCGTTAAG TCgacaatca 1861 acctctggat tacaaaattt gtgaaagatt