Construct: ORF TRCN0000472366
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011976.1_s317c1
- Derived from:
- ccsbBroadEn_02399
- DNA Barcode:
- AGCAATGCCGTTTCCAGAAAGTGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TNIP1 (10318)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472366
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001252390.2 | 100% | 100% | |
| 2 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001252391.2 | 100% | 100% | |
| 3 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001258454.2 | 100% | 100% | |
| 4 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_006058.5 | 100% | 100% | |
| 5 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001252392.2 | 98.1% | 97.9% | (many diffs) |
| 6 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001252393.2 | 98.1% | 97.9% | (many diffs) |
| 7 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001252385.1 | 95.5% | 94% | 1779_1795del;1857_1858ins68 |
| 8 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | XM_005268355.2 | 95.5% | 94% | 1779_1795del;1857_1858ins68 |
| 9 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | XM_017008950.2 | 95.5% | 94% | 1779_1795del;1857_1858ins68 |
| 10 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001252386.2 | 91.6% | 91.6% | 0_1ins159 |
| 11 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | XM_017008945.2 | 90.6% | 88.8% | (many diffs) |
| 12 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | XM_017008946.2 | 90.6% | 88.8% | (many diffs) |
| 13 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | XM_017008947.2 | 90.6% | 88.8% | (many diffs) |
| 14 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001258455.1 | 89.9% | 89.9% | 1586_1587ins192 |
| 15 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001364487.2 | 89.9% | 89.9% | 1586_1587ins192 |
| 16 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001364486.2 | 89.9% | 89.7% | (many diffs) |
| 17 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | XM_006714752.3 | 88.1% | 87.9% | (many diffs) |
| 18 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | NM_001258456.1 | 83.7% | 84.1% | (many diffs) |
| 19 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | XM_017008948.2 | 83% | 81.3% | (many diffs) |
| 20 | human | 10318 | TNIP1 | TNFAIP3 interacting protein 1 | XM_017008949.2 | 81.5% | 79.7% | (many diffs) |
| 21 | mouse | 57783 | Tnip1 | TNFAIP3 interacting protein 1 | NM_001199275.2 | 83.1% | 82.7% | (many diffs) |
| 22 | mouse | 57783 | Tnip1 | TNFAIP3 interacting protein 1 | NM_021327.4 | 83.1% | 82.7% | (many diffs) |
| 23 | mouse | 57783 | Tnip1 | TNFAIP3 interacting protein 1 | XM_006533846.3 | 83.1% | 82.7% | (many diffs) |
| 24 | mouse | 57783 | Tnip1 | TNFAIP3 interacting protein 1 | NM_001271456.1 | 82% | 81.4% | (many diffs) |
| 25 | mouse | 57783 | Tnip1 | TNFAIP3 interacting protein 1 | XM_011249162.1 | 82% | 81.4% | (many diffs) |
| 26 | mouse | 57783 | Tnip1 | TNFAIP3 interacting protein 1 | NM_001199276.2 | 76% | 75.6% | (many diffs) |
| 27 | mouse | 57783 | Tnip1 | TNFAIP3 interacting protein 1 | NM_001271455.1 | 76% | 75.6% | (many diffs) |
| 28 | mouse | 57783 | Tnip1 | TNFAIP3 interacting protein 1 | XM_006533847.3 | 76% | 75.6% | (many diffs) |
| 29 | mouse | 57783 | Tnip1 | TNFAIP3 interacting protein 1 | XM_011249163.2 | 76% | 75.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1974
- ORF length:
- 1908
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga agggagagga ccgtaccgga tctacgaccc tgggggcagc gtgccctcag 121 gagaggcatc cgcagctttt gagcgcctag tgaaggagaa ttcccggctg aaggaaaaaa 181 tgcaagggat aaagatgtta ggggagcttt tggaagagtc ccagatggaa gcgaccaggc 241 tccggcagaa ggcagaggag ctagtgaagg acaacgagct gctcccacca ccttctccct 301 ccttgggctc cttcgacccc ctggctgagc tcacaggaaa ggactcaaat gtcacagcat 361 ctcccacagc ccctgcatgc cccagtgaca agccagcacc agtccagaag cctccatcca 421 gtggcacctc ctctgaattt gaagtggtca ctcctgagga gcagaattca ccagagagca 481 gcagccatgc caatgcgatg gcgctgggcc ccctgccccg tgaggacggc aacctgatgc 541 tgcacctgca gcgcctggag accacgctga gtgtgtgtgc cgaggagccg gaccacggcc 601 agctcttcac ccacctgggc cgcatggccc tggagttcaa ccgactggca tccaaggtgc 661 acaagaatga gcagcgcacc tccattctgc agaccctgtg tgagcagctt cggaaggaga 721 acgaggctct gaaggccaag ttggataagg gcctggaaca gcgggatcag gctgccgaga 781 ggctgcggga ggaaaatttg gagctcaaga agttgttgat gagcaatggc aacaaagagg 841 gtgcgtctgg gcggccaggc tcaccgaaga tggaagggac aggcaagaag gcagtggctg 901 gacagcagca ggctagtgtg acggcaggta aggtcccaga ggtggtggcc ttgggcgcag 961 ccgagaagaa ggtgaagatg ctggagcagc agcgcagtga gctgctggaa gtgaacaagc 1021 agtgggacca gcatttccgg tccatgaagc agcagtatga gcagaagatc actgagctgc 1081 gtcagaagct ggctgatttg cagaagcagg tgactgacct ggaggccgag cgggagcaga 1141 agcagcgtga ctttgaccgc aagctcctcc tggccaagtc caagattgaa atggaggaga 1201 ccgacaagga gcagctgaca gcagaggcca aggagctgcg ccaaaaggtc aagtacctgc 1261 aggatcagct gagcccactc acccgacagc gtgagtacca ggaaaaggag atccagcggc 1321 tcaacaaggc cctggaggaa gcactgagca tccaaacccc gccatcatct ccaccaacag 1381 catttgggag cccagaagga gcaggggccc tcctaaggaa acaggagctg gtcacgcaga 1441 atgagttgct gaaacagcag gtgaagatct tcgaggagga cttccagagg gagcgcagtg 1501 atcgtgagcg catgaatgag gagaaggaag agctgaagaa gcaagtggag aagctgcagg 1561 cccaggtcac cctgtcaaat gcccagctaa aagcattcaa agatgaggag aaggcaagag 1621 aagccctcag acagcagaag aggaaagcaa aggcctcagg agagcgttac catgtggagc 1681 cccacccaga acatctctgc ggggcctacc cctacgccta cccgcccatg ccagccatgg 1741 tgccacacca tggcttcGAG GACTGGTCCC AGATCCGCTA CCCCCCTCCC CCCATGGCCA 1801 TGGAGCACCC GCCCCCACTC CCCAACTCGC GCCTCTTCCA TCTGCCGGAA TACACCTGGC 1861 GTCTACCCTG TGGAGGGGTT CGAAATCCAA ATCAGAGCTC CCAAGTGATG GACCCTCCCA 1921 CAGCCAGGCC TACAGAACCA GAGTCTCCAA AAAATGACCG TGAGGGGCCT CAGTGCCCAA 1981 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 2041 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 2101 TATCTTGTGG AAAGGACGAA GCAATGCCGT TTCCAGAAAG TGGACGCGTT AAGTCgacaa 2161 tcaacctctg gattacaaaa tttgtgaaag att