Transcript: Mouse NM_001199275.2

Mus musculus TNFAIP3 interacting protein 1 (Tnip1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tnip1 (57783)
Length:
2996
CDS:
303..2246

Additional Resources:

NCBI RefSeq record:
NM_001199275.2
NBCI Gene record:
Tnip1 (57783)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199275.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124118 GTTGCTGAAACAGCAGGTAAA pLKO.1 1721 CDS 100% 10.800 15.120 N Tnip1 n/a
2 TRCN0000326673 GTTGCTGAAACAGCAGGTAAA pLKO_005 1721 CDS 100% 10.800 15.120 N Tnip1 n/a
3 TRCN0000124114 CCTAAGAATGAGGTGCAACAA pLKO.1 2560 3UTR 100% 4.950 6.930 N Tnip1 n/a
4 TRCN0000326748 CCTAAGAATGAGGTGCAACAA pLKO_005 2560 3UTR 100% 4.950 6.930 N Tnip1 n/a
5 TRCN0000339238 TGAGGCTGCAGTGGGTCATTT pLKO_005 2244 CDS 100% 13.200 10.560 N Tnip1 n/a
6 TRCN0000306356 GCCAGTGTGATGGCGAGTAAA pLKO_005 1188 CDS 100% 13.200 9.240 N Tnip1 n/a
7 TRCN0000008684 CGGTCCATGAAGCAGCAGTAT pLKO.1 1314 CDS 100% 4.950 3.465 N TNIP1 n/a
8 TRCN0000124116 GAACGTCTAGTGGAGGAGAAT pLKO.1 378 CDS 100% 4.950 3.465 N Tnip1 n/a
9 TRCN0000124115 GCAACGAGAATACCAGGAGAA pLKO.1 1562 CDS 100% 4.050 2.835 N Tnip1 n/a
10 TRCN0000326675 GCAACGAGAATACCAGGAGAA pLKO_005 1562 CDS 100% 4.050 2.835 N Tnip1 n/a
11 TRCN0000124117 CCGGTCCATGAAGCAGCAGTA pLKO.1 1313 CDS 100% 1.350 0.945 N Tnip1 n/a
12 TRCN0000326749 CCGGTCCATGAAGCAGCAGTA pLKO_005 1313 CDS 100% 1.350 0.945 N Tnip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199275.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02399 pDONR223 100% 83.1% 82.7% None (many diffs) n/a
2 ccsbBroad304_02399 pLX_304 0% 83.1% 82.7% V5 (many diffs) n/a
3 TRCN0000472366 AGCAATGCCGTTTCCAGAAAGTGG pLX_317 11.7% 83.1% 82.7% V5 (many diffs) n/a
4 ccsbBroadEn_15702 pDONR223 0% 83.1% 82.5% None (many diffs) n/a
5 ccsbBroad304_15702 pLX_304 0% 83.1% 82.5% V5 (many diffs) n/a
6 TRCN0000474117 GCTATCACGCCCCTCGGAGTTGTT pLX_317 7.7% 83.1% 82.5% V5 (many diffs) n/a
7 ccsbBroadEn_11481 pDONR223 100% 82.3% 81.9% None (many diffs) n/a
Download CSV