Transcript: Human NM_001258455.1

Homo sapiens TNFAIP3 interacting protein 1 (TNIP1), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
TNIP1 (10318)
Length:
2525
CDS:
37..1755

Additional Resources:

NCBI RefSeq record:
NM_001258455.1
NBCI Gene record:
TNIP1 (10318)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008681 CCAATTTGTGTGTGTGTTTAA pLKO.1 2145 3UTR 100% 13.200 9.240 N TNIP1 n/a
2 TRCN0000356647 CCACCCAGAAGGCTTTCATTT pLKO_005 1936 3UTR 100% 13.200 9.240 N TNIP1 n/a
3 TRCN0000008682 CCTGTCAAATGCCCAGCTAAA pLKO.1 1542 CDS 100% 10.800 7.560 N TNIP1 n/a
4 TRCN0000378197 TGATGAGCAATGGCAACAAAG pLKO_005 788 CDS 100% 10.800 7.560 N TNIP1 n/a
5 TRCN0000008684 CGGTCCATGAAGCAGCAGTAT pLKO.1 1009 CDS 100% 4.950 3.465 N TNIP1 n/a
6 TRCN0000008683 GCTCACAGGAAAGGACTCAAA pLKO.1 300 CDS 100% 4.950 3.465 N TNIP1 n/a
7 TRCN0000124117 CCGGTCCATGAAGCAGCAGTA pLKO.1 1008 CDS 100% 1.350 0.945 N Tnip1 n/a
8 TRCN0000326749 CCGGTCCATGAAGCAGCAGTA pLKO_005 1008 CDS 100% 1.350 0.945 N Tnip1 n/a
9 TRCN0000008685 GATGAGGAGAAGGCAAGAGAA pLKO.1 1573 CDS 100% 4.950 2.970 N TNIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02399 pDONR223 100% 89.9% 89.9% None 1586_1587ins192 n/a
2 ccsbBroad304_02399 pLX_304 0% 89.9% 89.9% V5 1586_1587ins192 n/a
3 TRCN0000472366 AGCAATGCCGTTTCCAGAAAGTGG pLX_317 11.7% 89.9% 89.9% V5 1586_1587ins192 n/a
4 ccsbBroadEn_15702 pDONR223 0% 89.8% 89.7% None 443G>A;1586_1587ins192 n/a
5 ccsbBroad304_15702 pLX_304 0% 89.8% 89.7% V5 443G>A;1586_1587ins192 n/a
6 TRCN0000474117 GCTATCACGCCCCTCGGAGTTGTT pLX_317 7.7% 89.8% 89.7% V5 443G>A;1586_1587ins192 n/a
7 ccsbBroadEn_11481 pDONR223 100% 88.9% 88.8% None 1586_1587ins192;1698_1716delinsA n/a
Download CSV