Construct: ORF TRCN0000472401
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002368.1_s317c1
- Derived from:
- ccsbBroadEn_04634
- DNA Barcode:
- CATGACACGTCGAATGCAGAGCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SGF29 (112869)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472401
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 112869 | SGF29 | SAGA complex associated fac... | NM_138414.3 | 100% | 100% | |
| 2 | human | 112869 | SGF29 | SAGA complex associated fac... | XM_017022894.1 | 87.5% | 87% | (many diffs) |
| 3 | human | 112869 | SGF29 | SAGA complex associated fac... | XR_001751821.1 | 74.9% | 1_198del;610_611insGTGACAA;1071_1157del | |
| 4 | mouse | 75565 | Sgf29 | SAGA complex associated fac... | NM_029339.3 | 90.7% | 98.2% | (many diffs) |
| 5 | mouse | 75565 | Sgf29 | SAGA complex associated fac... | XM_017312365.1 | 90.7% | 98.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 945
- ORF length:
- 879
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cctcgtgtct gccgattccc gcattgcaga acttctcaca gagctccatc 121 agctgatcaa acaaacccag gaagagcgtt cgcggagcga acacaactta gtgaacatcc 181 agaagaccca tgagcggatg cagacagaga acaagatttc tccctattac cggacaaagc 241 tgcgtggcct ctacacaacc gccaaggccg atgcagaggc tgagtgcaac atccttcgga 301 aagctctgga caagatcgcg gaaatcaagt ctctgttgga agagaggcgg attgcggcca 361 agattgccgg tctctacaat gactcggagc caccccggaa gaccatgcgc agaggggtgc 421 tgatgaccct gctgcagcag tcggccatga ccctgcccct gtggatcggg aagcctggtg 481 acaagccccc acccctctgt ggggccatcc ctgcctcagg agactacgtg gCCAGACCTG 541 GAGACAAGGT GGCTGCCCGG GTGAAGGCCG TGGATGGGGA CGAGCAGTGG ATCCTGGCCG 601 AGGTGGTCAG TTACAGCCAT GCCACCAACA AGTATGAGGT AGATGACATC GATGAAGAAG 661 GCAAAGAGAG ACACACCCTG AGCCGGCGCC GTGTCATCCC GCTGCCCCAG TGGAAGGCCA 721 ACCCGGAGAC GGACCCTGAG GCCTTGTTCC AGAAGGAGCA GCTCGTGCTG GCCCTGTATC 781 CCCAGACTAC CTGCTTCTAC CGCGCCCTGA TCCATGCGCC CCCACAGCGG CCCCAGGATG 841 ACTACTCGGT CCTGTTTGAA GACACCTCCT ATGCAGATGG CTATTCCCCT CCCCTCAATG 901 TGGCTCAGAG ATACGTGGTG GCTTGTAAGG AACCCAAGAA AAAGTGCCCA ACTTTCTTGT 961 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1021 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1081 GAAAGGACGA CATGACACGT CGAATGCAGA GCATACGCGT TAAGTCgaca atcaacctct 1141 ggattacaaa atttgtgaaa gatt