Transcript: Human XM_017022894.1

PREDICTED: Homo sapiens SAGA complex associated factor 29 (SGF29), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGF29 (112869)
Length:
1494
CDS:
199..975

Additional Resources:

NCBI RefSeq record:
XM_017022894.1
NBCI Gene record:
SGF29 (112869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144091 CGAACACAACTTAGTGAACAT pLKO.1 291 CDS 100% 4.950 6.930 N SGF29 n/a
2 TRCN0000141325 CGCGGAAATCAAGTCTCTGTT pLKO.1 450 CDS 100% 4.950 6.930 N SGF29 n/a
3 TRCN0000144162 CAACTTAGTGAACATCCAGAA pLKO.1 297 CDS 100% 4.050 3.240 N SGF29 n/a
4 TRCN0000145234 GAAATCAAGTCTCTGTTGGAA pLKO.1 454 CDS 100% 3.000 2.400 N SGF29 n/a
5 TRCN0000143633 GATGCAGACAGAGAACAAGAT pLKO.1 330 CDS 100% 4.950 3.465 N SGF29 n/a
6 TRCN0000122010 GAGAACAAGATTTCTCCCTAT pLKO.1 340 CDS 100% 0.405 0.284 N SGF29 n/a
7 TRCN0000142585 GAGCTCCATCAGCTGATCAAA pLKO.1 244 CDS 100% 5.625 3.375 N SGF29 n/a
8 TRCN0000142070 GCCACCAACAAGTATGAGGTA pLKO.1 754 CDS 100% 2.640 1.584 N SGF29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04634 pDONR223 100% 87.5% 87% None (many diffs) n/a
2 ccsbBroad304_04634 pLX_304 0% 87.5% 87% V5 (many diffs) n/a
3 TRCN0000472401 CATGACACGTCGAATGCAGAGCAT pLX_317 47.1% 87.5% 87% V5 (many diffs) n/a
Download CSV