Transcript: Mouse XM_017312365.1

PREDICTED: Mus musculus SAGA complex associated factor 29 (Sgf29), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgf29 (75565)
Length:
1273
CDS:
299..1180

Additional Resources:

NCBI RefSeq record:
XM_017312365.1
NBCI Gene record:
Sgf29 (75565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375575 AGATCGCAGGTCTCTACAATG pLKO_005 594 CDS 100% 10.800 15.120 N Sgf29 n/a
2 TRCN0000364035 AGTATGAGGTAGACGACATTG pLKO_005 864 CDS 100% 10.800 15.120 N Sgf29 n/a
3 TRCN0000039306 CCTAGCTGAAGTAGTCAGTTA pLKO.1 826 CDS 100% 4.950 6.930 N Sgf29 n/a
4 TRCN0000039308 CTGTTTGAAGACACCTCTTAT pLKO.1 1085 CDS 100% 13.200 9.240 N Sgf29 n/a
5 TRCN0000352138 CTGTTTGAAGACACCTCTTAT pLKO_005 1085 CDS 100% 13.200 9.240 N Sgf29 n/a
6 TRCN0000039305 GCTTGTAAGGAGCCCAAGAAA pLKO.1 1154 CDS 100% 5.625 3.938 N Sgf29 n/a
7 TRCN0000143633 GATGCAGACAGAGAACAAGAT pLKO.1 430 CDS 100% 4.950 3.465 N SGF29 n/a
8 TRCN0000039304 GCTGGATAAGATAGCTGAGAT pLKO.1 538 CDS 100% 4.950 3.465 N Sgf29 n/a
9 TRCN0000352057 GCTGGATAAGATAGCTGAGAT pLKO_005 538 CDS 100% 4.950 3.465 N Sgf29 n/a
10 TRCN0000039307 GAGAACAAGATTTCTCCTTAT pLKO.1 440 CDS 100% 1.080 0.756 N Sgf29 n/a
11 TRCN0000352056 GAGAACAAGATTTCTCCTTAT pLKO_005 440 CDS 100% 1.080 0.756 N Sgf29 n/a
12 TRCN0000142585 GAGCTCCATCAGCTGATCAAA pLKO.1 344 CDS 100% 5.625 3.938 N SGF29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04634 pDONR223 100% 90.7% 98.2% None (many diffs) n/a
2 ccsbBroad304_04634 pLX_304 0% 90.7% 98.2% V5 (many diffs) n/a
3 TRCN0000472401 CATGACACGTCGAATGCAGAGCAT pLX_317 47.1% 90.7% 98.2% V5 (many diffs) n/a
Download CSV