Construct: ORF TRCN0000472426
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006046.1_s317c1
- Derived from:
- ccsbBroadEn_03549
- DNA Barcode:
- ATCTACAGGTGCTTCTTTGCGACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DCUN1D2 (55208)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472426
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55208 | DCUN1D2 | defective in cullin neddyla... | NM_001014283.2 | 100% | 100% | |
| 2 | human | 55208 | DCUN1D2 | defective in cullin neddyla... | XM_017020644.1 | 94.2% | 94.2% | 0_1ins45 |
| 3 | human | 55208 | DCUN1D2 | defective in cullin neddyla... | XM_017020646.2 | 94.2% | 94.2% | 0_1ins45 |
| 4 | human | 55208 | DCUN1D2 | defective in cullin neddyla... | XM_017020647.1 | 94.2% | 94.2% | 0_1ins45 |
| 5 | human | 55208 | DCUN1D2 | defective in cullin neddyla... | XM_017020648.1 | 94.2% | 94.2% | 0_1ins45 |
| 6 | human | 55208 | DCUN1D2 | defective in cullin neddyla... | XM_017020649.1 | 81.8% | 73.7% | (many diffs) |
| 7 | human | 55208 | DCUN1D2 | defective in cullin neddyla... | XM_017020643.1 | 76.5% | 76.5% | 1_236del;237_238insTG |
| 8 | human | 55208 | DCUN1D2 | defective in cullin neddyla... | XR_245842.3 | 24.4% | 1_40del;560_711del;970_3182del | |
| 9 | mouse | 102323 | Dcun1d2 | DCN1, defective in cullin n... | NM_001024504.2 | 87% | 91.1% | (many diffs) |
| 10 | mouse | 102323 | Dcun1d2 | DCN1, defective in cullin n... | XM_006508684.2 | 81.7% | 85.7% | (many diffs) |
| 11 | mouse | 102323 | Dcun1d2 | DCN1, defective in cullin n... | NM_001042651.1 | 69.3% | 70.6% | (many diffs) |
| 12 | mouse | 102323 | Dcun1d2 | DCN1, defective in cullin n... | NM_001042650.1 | 66.4% | 68.7% | (many diffs) |
| 13 | mouse | 102323 | Dcun1d2 | DCN1, defective in cullin n... | NM_001042649.1 | 65.8% | 58.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 843
- ORF length:
- 777
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca taagcttaaa tcgtctcaga aggacaaggt ccgccagttt atggcgtgca 121 ctcaggctgg cgagagaact gctatctact gcttaacgca gaatgagtgg agactagacg 181 aggccacgga cagcttcttc caaaacccag actcgctcca cagggagtcc atgcggaacg 241 ctgtggacaa gaagaagctg gagcggctgt acggcaggta caaagatcca caagatgaaa 301 acaaaattgg agtcgatggg attcaacagt tttgtgatga tctgagcctg gatcctgcca 361 gtatcagtgt attggtcata gcgtggaagt tcagggcagc aactcagtgt gaatttagca 421 gaaaggaatT TCTAGATGGC ATGACAGAAC TTGGGTGTGA CAGCATGGAG AAGCTAAAGG 481 CTCTTCTGCC AAGACTGGAG CAGGAGCTGA AGGACACAGC CAAGTTTAAA GATTTTTATC 541 AGTTTACCTT CACCTTCGCT AAGAACCCAG GGCAGAAAGG TTTAGACTTA GAAATGGCTG 601 TTGCGTATTG GAAATTAGTG TTATCTGGAA GGTTTAAATT TTTAGATCTC TGGAACACAT 661 TCTTAATGGA ACATCACAAA AGATCAATTC CAAGGGACAC CTGGAACCTC CTGCTGGACT 721 TTGGAAACAT GATTGCGGAT GATATGTCTA ACTACGATGA AGAAGGAGCT TGGCCCGTTC 781 TTATAGATGA TTTTGTAGAA TATGCACGGC CAGTAGTCAC AGGTGGAAAA CGCAGCCTTT 841 TCTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 901 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 961 GGCTTTATAT ATCTTGTGGA AAGGACGAAT CTACAGGTGC TTCTTTGCGA CAACGCGTTA 1021 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt