Transcript: Human XM_017020648.1

PREDICTED: Homo sapiens defective in cullin neddylation 1 domain containing 2 (DCUN1D2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCUN1D2 (55208)
Length:
4253
CDS:
1309..2043

Additional Resources:

NCBI RefSeq record:
XM_017020648.1
NBCI Gene record:
DCUN1D2 (55208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140573 GCGAGAGAACTGCTATCTACT pLKO.1 1328 CDS 100% 4.950 3.960 N DCUN1D2 n/a
2 TRCN0000338645 GCGAGAGAACTGCTATCTACT pLKO_005 1328 CDS 100% 4.950 3.960 N DCUN1D2 n/a
3 TRCN0000139757 CATGACAGAACTTGGGTGTGA pLKO.1 1638 CDS 100% 2.640 2.112 N DCUN1D2 n/a
4 TRCN0000338647 GATCTTGTCGTAGAGTCTAAT pLKO_005 2514 3UTR 100% 13.200 9.240 N DCUN1D2 n/a
5 TRCN0000121807 GAACTGCTATCTACTGCTTAA pLKO.1 1334 CDS 100% 10.800 7.560 N DCUN1D2 n/a
6 TRCN0000140555 GAACGCTGTGGACAAGAAGAA pLKO.1 1434 CDS 100% 4.950 3.465 N DCUN1D2 n/a
7 TRCN0000121884 GTGAATTTAGCAGAAAGGAAT pLKO.1 1607 CDS 100% 4.950 3.465 N DCUN1D2 n/a
8 TRCN0000338646 GTGAATTTAGCAGAAAGGAAT pLKO_005 1607 CDS 100% 4.950 3.465 N DCUN1D2 n/a
9 TRCN0000139689 CTAAAGGCTCTTCTGCCAAGA pLKO.1 1672 CDS 100% 4.050 2.835 N DCUN1D2 n/a
10 TRCN0000140041 GAATGAGTGGAGACTAGACGA pLKO.1 1359 CDS 100% 2.640 1.848 N DCUN1D2 n/a
11 TRCN0000143286 GAGAACTGCTATCTACTGCTT pLKO.1 1332 CDS 100% 2.640 1.848 N DCUN1D2 n/a
12 TRCN0000139606 CAGTTTACCTTCACCTTCGCT pLKO.1 1738 CDS 100% 0.750 0.525 N DCUN1D2 n/a
13 TRCN0000144083 CAGCAACTCAGTGTGAATTTA pLKO.1 1595 CDS 100% 15.000 9.000 N DCUN1D2 n/a
14 TRCN0000350923 CAGCAACTCAGTGTGAATTTA pLKO_005 1595 CDS 100% 15.000 9.000 N DCUN1D2 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2910 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2910 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2910 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2990 3UTR 100% 4.950 2.475 Y ORAI2 n/a
19 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2987 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03549 pDONR223 100% 94.2% 94.2% None 0_1ins45 n/a
2 ccsbBroad304_03549 pLX_304 0% 94.2% 94.2% V5 0_1ins45 n/a
3 TRCN0000472426 ATCTACAGGTGCTTCTTTGCGACA pLX_317 53.1% 94.2% 94.2% V5 0_1ins45 n/a
Download CSV