Transcript: Mouse NM_001024504.2

Mus musculus DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) (Dcun1d2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Dcun1d2 (102323)
Length:
3059
CDS:
321..1100

Additional Resources:

NCBI RefSeq record:
NM_001024504.2
NBCI Gene record:
Dcun1d2 (102323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262105 CCGCCACTCAATGTGAATTTA pLKO_005 652 CDS 100% 15.000 21.000 N Dcun1d2 n/a
2 TRCN0000262104 GCATATTGGAAGTTAGTATTG pLKO_005 858 CDS 100% 10.800 15.120 N Dcun1d2 n/a
3 TRCN0000262107 TCAAGGACCTTTACCAGTTTA pLKO_005 781 CDS 100% 13.200 10.560 N Dcun1d2 n/a
4 TRCN0000262108 TCTAATGAGGTTATCACTATA pLKO_005 1719 3UTR 100% 13.200 9.240 N Dcun1d2 n/a
5 TRCN0000262106 GCGTTTCACCGAGAGTCTATG pLKO_005 468 CDS 100% 10.800 7.560 N Dcun1d2 n/a
6 TRCN0000139606 CAGTTTACCTTCACCTTCGCT pLKO.1 795 CDS 100% 0.750 0.525 N DCUN1D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03549 pDONR223 100% 87% 91.1% None (many diffs) n/a
2 ccsbBroad304_03549 pLX_304 0% 87% 91.1% V5 (many diffs) n/a
3 TRCN0000472426 ATCTACAGGTGCTTCTTTGCGACA pLX_317 53.1% 87% 91.1% V5 (many diffs) n/a
Download CSV