Construct: ORF TRCN0000472429
Construct Description:
- Construct Type:
 - ORF
 - Other Identifiers:
 - ORF004682.1_s317c1
 - Derived from:
 - ccsbBroadEn_07577
 - DNA Barcode:
 - TATCAGACCTGTGGTAAAAGTGTG
 - Epitope Tag:
 - V5
 - Notes:
 - No stop codon in insert
 
Originally Annotated References:
- Gene:
 - KCNMB2 (10242)
 
Vector Information:
- Vector Backbone:
 - pLX_317
 - Pol II Cassette 1:
 - SV40-PuroR
 - Pol II Cassette 2:
 - EF1a-TRCN0000472429
 - Selection Marker:
 - PuroR
 - Visible Reporter:
 - n/a
 - Epitope Tag:
 - n/a
 
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows:  total nt. matches ---------------------------------- aligned length (incl. gaps)  | 
              Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows:  total aa. matches ---------------------------------- aligned length (incl. gaps)  | 
              Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10242 | KCNMB2 | potassium calcium-activated... | NM_001278911.2 | 99.7% | 100% | 288T>C;564A>C | 
| 2 | human | 10242 | KCNMB2 | potassium calcium-activated... | NM_005832.5 | 99.7% | 100% | 288T>C;564A>C | 
| 3 | human | 10242 | KCNMB2 | potassium calcium-activated... | NM_181361.3 | 99.7% | 100% | 288T>C;564A>C | 
| 4 | human | 10242 | KCNMB2 | potassium calcium-activated... | XM_011512325.2 | 99.7% | 100% | 288T>C;564A>C | 
| 5 | mouse | 72413 | Kcnmb2 | potassium large conductance... | NM_028231.2 | 88.9% | 95.3% | (many diffs) | 
| 6 | mouse | 72413 | Kcnmb2 | potassium large conductance... | XM_006535549.4 | 88.9% | 95.3% | (many diffs) | 
| 7 | mouse | 72413 | Kcnmb2 | potassium large conductance... | XM_006535550.2 | 88.9% | 95.3% | (many diffs) | 
| 8 | mouse | 72413 | Kcnmb2 | potassium large conductance... | XM_006535551.3 | 88.9% | 95.3% | (many diffs) | 
| 9 | mouse | 72413 | Kcnmb2 | potassium large conductance... | XM_017319742.2 | 88.9% | 95.3% | (many diffs) | 
| 10 | mouse | 72413 | Kcnmb2 | potassium large conductance... | XM_006535548.4 | 79.1% | 84.8% | (many diffs) | 
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
 - 66
 - ORF end:
 - 771
 - ORF length:
 - 705
 - Sequence:
 - 
          
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt tatatggacc agtggccgga cctcttcatc ttatagacat gatgaaaaaa 121 gaaatattta ccagaaaatc agggaccatg acctcctgga caaaaggaaa acagtcacag 181 cactgaaggc aggagaggac cgagctattc tcctgggact ggctatgatg gtgtgctcca 241 tcatgatgta ttttctgctg ggaatcacac tcctgcgctc atacatgcag agcgtgtgga 301 ccgaagagtc tcaatgcacc ttgctgaatg cgtccatcac ggaaacattt aactgctcct 361 tcagctgtgg tccagactgc tggaaacttt ctcagtaccc ctgcctccag gtgtacgtta 421 acctgacttc ttccggggaa aagctccTCC TCTACCACAC AGAAGAGACA ATAAAAATCA 481 ATCAGAAGTG CTCCTATATA CCTAAATGTG GAAAAAATTT TGAAGAATCC ATGTCCCTGG 541 TGAATGTTGT CATGGAAAAC TTCAGGAAGT ATCAACACTT CTCCTGCTAT TCTGACCCAG 601 AAGGAAACCA GAAGAGTGTT ATCCTAACCA AACTCTACAG TTCCAACGTG CTGTTCCATT 661 CACTCTTCTG GCCAACCTGT ATGATGGCTG GGGGTGTGGC AATTGTTGCC ATGGTGAAAC 721 TTACACAGTA CCTCTCCCTA CTATGTGAGA GGATCCAACG GATCAATAGA TACCCAACTT 781 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 841 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 901 CTTGTGGAAA GGACGATATC AGACCTGTGG TAAAAGTGTG ACGCGTTAAG TCgacaatca 961 acctctggat tacaaaattt gtgaaagatt