Transcript: Mouse NM_028231.2

Mus musculus potassium large conductance calcium-activated channel, subfamily M, beta member 2 (Kcnmb2), mRNA.

Source:
NCBI, updated 2019-02-16
Taxon:
Mus musculus (mouse)
Gene:
Kcnmb2 (72413)
Length:
2947
CDS:
391..1098

Additional Resources:

NCBI RefSeq record:
NM_028231.2
NBCI Gene record:
Kcnmb2 (72413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068897 GAGACCATGAAGATCAATCAA pLKO.1 790 CDS 100% 5.625 3.938 N Kcnmb2 n/a
2 TRCN0000068896 CCCTGCTGAATGTGTCAATCA pLKO.1 644 CDS 100% 4.950 3.465 N Kcnmb2 n/a
3 TRCN0000068895 GCAATCGTTGCTATGGTGAAA pLKO.1 1024 CDS 100% 4.950 3.465 N Kcnmb2 n/a
4 TRCN0000068893 GCTCCAATGTGCTGTTCCATT pLKO.1 965 CDS 100% 4.950 3.465 N Kcnmb2 n/a
5 TRCN0000068894 CCTATATTCCTAAGTGTGGAA pLKO.1 818 CDS 100% 2.640 1.848 N Kcnmb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07577 pDONR223 100% 88.9% 95.3% None (many diffs) n/a
2 ccsbBroad304_07577 pLX_304 0% 88.9% 95.3% V5 (many diffs) n/a
3 TRCN0000472429 TATCAGACCTGTGGTAAAAGTGTG pLX_317 46% 88.9% 95.3% V5 (many diffs) n/a
Download CSV