Transcript: Mouse XM_006535550.2

PREDICTED: Mus musculus potassium large conductance calcium-activated channel, subfamily M, beta member 2 (Kcnmb2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Kcnmb2 (72413)
Length:
2525
CDS:
410..1117

Additional Resources:

NCBI RefSeq record:
XM_006535550.2
NBCI Gene record:
Kcnmb2 (72413)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068897 GAGACCATGAAGATCAATCAA pLKO.1 809 CDS 100% 5.625 3.938 N Kcnmb2 n/a
2 TRCN0000068896 CCCTGCTGAATGTGTCAATCA pLKO.1 663 CDS 100% 4.950 3.465 N Kcnmb2 n/a
3 TRCN0000068895 GCAATCGTTGCTATGGTGAAA pLKO.1 1043 CDS 100% 4.950 3.465 N Kcnmb2 n/a
4 TRCN0000068893 GCTCCAATGTGCTGTTCCATT pLKO.1 984 CDS 100% 4.950 3.465 N Kcnmb2 n/a
5 TRCN0000068894 CCTATATTCCTAAGTGTGGAA pLKO.1 837 CDS 100% 2.640 1.848 N Kcnmb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07577 pDONR223 100% 88.9% 95.3% None (many diffs) n/a
2 ccsbBroad304_07577 pLX_304 0% 88.9% 95.3% V5 (many diffs) n/a
3 TRCN0000472429 TATCAGACCTGTGGTAAAAGTGTG pLX_317 46% 88.9% 95.3% V5 (many diffs) n/a
Download CSV