Construct: ORF TRCN0000472476
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017542.1_s317c1
- Derived from:
- ccsbBroadEn_09900
- DNA Barcode:
- ATTAATAATCGAGACTTTACAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MCM9 (254394)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472476
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 254394 | MCM9 | minichromosome maintenance ... | NM_153255.4 | 99.9% | 100% | 573G>A |
| 2 | human | 254394 | MCM9 | minichromosome maintenance ... | NM_017696.2 | 34% | 33.6% | (many diffs) |
| 3 | mouse | 71567 | Mcm9 | minichromosome maintenance ... | XM_006512856.3 | 86.1% | 88.9% | (many diffs) |
| 4 | mouse | 71567 | Mcm9 | minichromosome maintenance ... | XM_006512857.3 | 85.9% | 89.7% | (many diffs) |
| 5 | mouse | 71567 | Mcm9 | minichromosome maintenance ... | XM_017314097.1 | 30% | 31.1% | (many diffs) |
| 6 | mouse | 71567 | Mcm9 | minichromosome maintenance ... | NM_027830.2 | 26.3% | 27.3% | (many diffs) |
| 7 | mouse | 71567 | Mcm9 | minichromosome maintenance ... | XR_380074.3 | 19.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1239
- ORF length:
- 1173
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tagcgatcaa gttacactgg ttggtcaagt gtttgagtca tatgtttcgg 121 aataccataa gaatgatatt cttctaatct tgaaggaaag ggatgaagat gctcattacc 181 cagttgtggt taatgccatg actctgtttg agaccaacat ggaaatcggg gaatatttca 241 acatgttccc cagtgaagtg cttacaattt ttgatagtgc actgcgaagg tcagccttga 301 caattctcca gtccctttct cagcctgagg ctgtttccat gaaacagaat cttcatgcca 361 ggatatcagg tttgcctgtc tgtcctgagc tggtgaggga acacatacct aaaaccaagg 421 atgtgggaca ctttttatct gtcactggga cagtgattcg aacaagtctg gtgaaggttc 481 tggagtttga gcgggattac atgtgtaaca aatgcaagca tgtgtttgtg atcaaggctg 541 actttgagca gtattacacc ttttgccggc catcctcgtg tcccagcttg gagagctgtg 601 attcctctaa attcacttgc ctctcaggct tgtcttcatc tccaaccagg tgtagagatt 661 accaggaaat caaaattcag gaacaggttc aaaggctaTC TGTTGGAAGT ATTCCACGAT 721 CTATGAAGGT TATTCTGGAA GATGACTTAG TGGATAGTTG CAAATCTGGT GATGACCTCA 781 CTATTTACGG GATTGTAATG CAACGGTGGA AGCCCTTTCA GCAAGATGTG CGCTGTGAAG 841 TGGAGATAGT CCTGAAAGCA AATTACATCC AAGTAAATAA TGAGCAGTCC TCAGGGATCA 901 TCATGGATGA GGAGGTCCAA AAGGAATTCG AAGATTTTTG GGAATACTAT AAGAGCGATC 961 CCTTTGCAGG AAGGAATGTA ATATTGGCTA GCTTGTGCCC TCAAGTGTTT GGAATGTATC 1021 TAGTAAAGCT TGCTGTGGCC ATGGTGCTGG CTGGTGGGAT TCAAAGGACT GATGCTACAG 1081 GAACACGGGT CAGAGGAGAA TCTCATCTTT TATTGGTTGG GGATCCTGGC ACAGGGAAAT 1141 CTCAGTTCCT CAAATATGCA GCAAAGATTA CACCAAGATC TGTGCTGACC ACAGGAATTG 1201 GATCTACTAG TGCAGGTATT GTATGTGACA ATTTCAAGTA CCCAACTTTC TTGTACAAAG 1261 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1321 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1381 ACGAATTAAT AATCGAGACT TTACAAATAC GCGTTAAGTC gacaatcaac ctctggatta 1441 caaaatttgt gaaagatt